ID: 991944547

View in Genome Browser
Species Human (GRCh38)
Location 5:71887233-71887255
Sequence ATTTTCCACATTAAGATCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991944544_991944547 -4 Left 991944544 5:71887214-71887236 CCCTGAGCCAGAAAACTTCATTT No data
Right 991944547 5:71887233-71887255 ATTTTCCACATTAAGATCAAAGG No data
991944545_991944547 -5 Left 991944545 5:71887215-71887237 CCTGAGCCAGAAAACTTCATTTT No data
Right 991944547 5:71887233-71887255 ATTTTCCACATTAAGATCAAAGG No data
991944543_991944547 -3 Left 991944543 5:71887213-71887235 CCCCTGAGCCAGAAAACTTCATT No data
Right 991944547 5:71887233-71887255 ATTTTCCACATTAAGATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991944547 Original CRISPR ATTTTCCACATTAAGATCAA AGG Intergenic
No off target data available for this crispr