ID: 991945479

View in Genome Browser
Species Human (GRCh38)
Location 5:71894846-71894868
Sequence TTGGGGGCTCAGAACTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991945479_991945493 25 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945493 5:71894894-71894916 GGCAGTCCTGCTCTAGGGAGGGG No data
991945479_991945487 4 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945487 5:71894873-71894895 GGAACACCAGTGTTGGTTGGAGG No data
991945479_991945494 26 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945479_991945486 1 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945486 5:71894870-71894892 TGAGGAACACCAGTGTTGGTTGG No data
991945479_991945490 20 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945479_991945485 -3 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945485 5:71894866-71894888 CAAATGAGGAACACCAGTGTTGG No data
991945479_991945489 19 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945489 5:71894888-71894910 GTTGGAGGCAGTCCTGCTCTAGG No data
991945479_991945492 24 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945492 5:71894893-71894915 AGGCAGTCCTGCTCTAGGGAGGG No data
991945479_991945491 23 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945491 5:71894892-71894914 GAGGCAGTCCTGCTCTAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991945479 Original CRISPR TTGGGGGCTCAGAACTAGCA AGG (reversed) Intergenic
No off target data available for this crispr