ID: 991945486

View in Genome Browser
Species Human (GRCh38)
Location 5:71894870-71894892
Sequence TGAGGAACACCAGTGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991945477_991945486 23 Left 991945477 5:71894824-71894846 CCTTAGCACGTTAGCCAAGAGGC No data
Right 991945486 5:71894870-71894892 TGAGGAACACCAGTGTTGGTTGG No data
991945475_991945486 24 Left 991945475 5:71894823-71894845 CCCTTAGCACGTTAGCCAAGAGG No data
Right 991945486 5:71894870-71894892 TGAGGAACACCAGTGTTGGTTGG No data
991945479_991945486 1 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945486 5:71894870-71894892 TGAGGAACACCAGTGTTGGTTGG No data
991945478_991945486 9 Left 991945478 5:71894838-71894860 CCAAGAGGCCTTGCTAGTTCTGA No data
Right 991945486 5:71894870-71894892 TGAGGAACACCAGTGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991945486 Original CRISPR TGAGGAACACCAGTGTTGGT TGG Intergenic
No off target data available for this crispr