ID: 991945490

View in Genome Browser
Species Human (GRCh38)
Location 5:71894889-71894911
Sequence TTGGAGGCAGTCCTGCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991945478_991945490 28 Left 991945478 5:71894838-71894860 CCAAGAGGCCTTGCTAGTTCTGA No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945482_991945490 3 Left 991945482 5:71894863-71894885 CCCCAAATGAGGAACACCAGTGT No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945479_991945490 20 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945484_991945490 1 Left 991945484 5:71894865-71894887 CCAAATGAGGAACACCAGTGTTG No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945483_991945490 2 Left 991945483 5:71894864-71894886 CCCAAATGAGGAACACCAGTGTT No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data
991945481_991945490 4 Left 991945481 5:71894862-71894884 CCCCCAAATGAGGAACACCAGTG No data
Right 991945490 5:71894889-71894911 TTGGAGGCAGTCCTGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991945490 Original CRISPR TTGGAGGCAGTCCTGCTCTA GGG Intergenic
No off target data available for this crispr