ID: 991945494

View in Genome Browser
Species Human (GRCh38)
Location 5:71894895-71894917
Sequence GCAGTCCTGCTCTAGGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991945484_991945494 7 Left 991945484 5:71894865-71894887 CCAAATGAGGAACACCAGTGTTG No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945482_991945494 9 Left 991945482 5:71894863-71894885 CCCCAAATGAGGAACACCAGTGT No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945488_991945494 -7 Left 991945488 5:71894879-71894901 CCAGTGTTGGTTGGAGGCAGTCC No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945481_991945494 10 Left 991945481 5:71894862-71894884 CCCCCAAATGAGGAACACCAGTG No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945479_991945494 26 Left 991945479 5:71894846-71894868 CCTTGCTAGTTCTGAGCCCCCAA No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data
991945483_991945494 8 Left 991945483 5:71894864-71894886 CCCAAATGAGGAACACCAGTGTT No data
Right 991945494 5:71894895-71894917 GCAGTCCTGCTCTAGGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991945494 Original CRISPR GCAGTCCTGCTCTAGGGAGG GGG Intergenic
No off target data available for this crispr