ID: 991946146

View in Genome Browser
Species Human (GRCh38)
Location 5:71900150-71900172
Sequence GACAGCTGTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991946143_991946146 16 Left 991946143 5:71900111-71900133 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG No data
991946142_991946146 17 Left 991946142 5:71900110-71900132 CCCTGCCATCTTCTGCAGATAAC 0: 180
1: 172
2: 120
3: 86
4: 284
Right 991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG No data
991946144_991946146 12 Left 991946144 5:71900115-71900137 CCATCTTCTGCAGATAACTACTG 0: 7
1: 193
2: 201
3: 113
4: 280
Right 991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991946146 Original CRISPR GACAGCTGTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr