ID: 991948335

View in Genome Browser
Species Human (GRCh38)
Location 5:71923361-71923383
Sequence AAGTGTTGGAAGGAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991948331_991948335 10 Left 991948331 5:71923328-71923350 CCATGAGAGTTCTGAGAATAGTT No data
Right 991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG No data
991948330_991948335 23 Left 991948330 5:71923315-71923337 CCACTAAAGCTTTCCATGAGAGT No data
Right 991948335 5:71923361-71923383 AAGTGTTGGAAGGAGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991948335 Original CRISPR AAGTGTTGGAAGGAGTATGA AGG Intergenic
No off target data available for this crispr