ID: 991949157

View in Genome Browser
Species Human (GRCh38)
Location 5:71931256-71931278
Sequence CTGTCTCCAAAGATGAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949152_991949157 26 Left 991949152 5:71931207-71931229 CCCAGAAGAAGAGAACACAGAAA No data
Right 991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG No data
991949153_991949157 25 Left 991949153 5:71931208-71931230 CCAGAAGAAGAGAACACAGAAAT No data
Right 991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949157 Original CRISPR CTGTCTCCAAAGATGAATTT GGG Intergenic
No off target data available for this crispr