ID: 991949557

View in Genome Browser
Species Human (GRCh38)
Location 5:71934078-71934100
Sequence CCTTCCCTCTGGGGCTCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949557_991949564 -7 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949564 5:71934094-71934116 GGGAAGGTTTGGGTGAGCAATGG No data
991949557_991949565 -6 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949565 5:71934095-71934117 GGAAGGTTTGGGTGAGCAATGGG No data
991949557_991949566 11 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949557_991949570 15 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949570 5:71934116-71934138 GGTGAATAGTCTCAGATGGGGGG No data
991949557_991949568 13 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949568 5:71934114-71934136 TGGGTGAATAGTCTCAGATGGGG No data
991949557_991949567 12 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949567 5:71934113-71934135 ATGGGTGAATAGTCTCAGATGGG No data
991949557_991949569 14 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949569 5:71934115-71934137 GGGTGAATAGTCTCAGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949557 Original CRISPR CCTTCCCTCTGGGGCTCAGC TGG (reversed) Intergenic