ID: 991949561

View in Genome Browser
Species Human (GRCh38)
Location 5:71934087-71934109
Sequence TCACCCAAACCTTCCCTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949561_991949572 25 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949572 5:71934135-71934157 GGGGTGTTTAGTCCAGACCTGGG No data
991949561_991949568 4 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949568 5:71934114-71934136 TGGGTGAATAGTCTCAGATGGGG No data
991949561_991949571 24 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG No data
991949561_991949567 3 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949567 5:71934113-71934135 ATGGGTGAATAGTCTCAGATGGG No data
991949561_991949570 6 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949570 5:71934116-71934138 GGTGAATAGTCTCAGATGGGGGG No data
991949561_991949566 2 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949561_991949573 29 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949573 5:71934139-71934161 TGTTTAGTCCAGACCTGGGAAGG No data
991949561_991949569 5 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949569 5:71934115-71934137 GGGTGAATAGTCTCAGATGGGGG No data
991949561_991949574 30 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949574 5:71934140-71934162 GTTTAGTCCAGACCTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949561 Original CRISPR TCACCCAAACCTTCCCTCTG GGG (reversed) Intergenic
No off target data available for this crispr