ID: 991949563

View in Genome Browser
Species Human (GRCh38)
Location 5:71934089-71934111
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949563_991949567 1 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949567 5:71934113-71934135 ATGGGTGAATAGTCTCAGATGGG No data
991949563_991949569 3 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949569 5:71934115-71934137 GGGTGAATAGTCTCAGATGGGGG No data
991949563_991949573 27 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949573 5:71934139-71934161 TGTTTAGTCCAGACCTGGGAAGG No data
991949563_991949571 22 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG No data
991949563_991949572 23 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949572 5:71934135-71934157 GGGGTGTTTAGTCCAGACCTGGG No data
991949563_991949575 29 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949575 5:71934141-71934163 TTTAGTCCAGACCTGGGAAGGGG No data
991949563_991949566 0 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949563_991949568 2 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949568 5:71934114-71934136 TGGGTGAATAGTCTCAGATGGGG No data
991949563_991949574 28 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949574 5:71934140-71934162 GTTTAGTCCAGACCTGGGAAGGG No data
991949563_991949570 4 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949570 5:71934116-71934138 GGTGAATAGTCTCAGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949563 Original CRISPR GCTCACCCAAACCTTCCCTC TGG (reversed) Intergenic