ID: 991949566

View in Genome Browser
Species Human (GRCh38)
Location 5:71934112-71934134
Sequence AATGGGTGAATAGTCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949557_991949566 11 Left 991949557 5:71934078-71934100 CCAGCTGAGCCCCAGAGGGAAGG No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949561_991949566 2 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949563_991949566 0 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data
991949562_991949566 1 Left 991949562 5:71934088-71934110 CCCAGAGGGAAGGTTTGGGTGAG No data
Right 991949566 5:71934112-71934134 AATGGGTGAATAGTCTCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949566 Original CRISPR AATGGGTGAATAGTCTCAGA TGG Intergenic