ID: 991949571

View in Genome Browser
Species Human (GRCh38)
Location 5:71934134-71934156
Sequence GGGGGTGTTTAGTCCAGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991949561_991949571 24 Left 991949561 5:71934087-71934109 CCCCAGAGGGAAGGTTTGGGTGA No data
Right 991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG No data
991949563_991949571 22 Left 991949563 5:71934089-71934111 CCAGAGGGAAGGTTTGGGTGAGC No data
Right 991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG No data
991949562_991949571 23 Left 991949562 5:71934088-71934110 CCCAGAGGGAAGGTTTGGGTGAG No data
Right 991949571 5:71934134-71934156 GGGGGTGTTTAGTCCAGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991949571 Original CRISPR GGGGGTGTTTAGTCCAGACC TGG Intergenic
No off target data available for this crispr