ID: 991950882

View in Genome Browser
Species Human (GRCh38)
Location 5:71945896-71945918
Sequence GACTGTCTGGAGATTAGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991950874_991950882 16 Left 991950874 5:71945857-71945879 CCTGCCTGAGGGAATGGTTATAT No data
Right 991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG No data
991950873_991950882 17 Left 991950873 5:71945856-71945878 CCCTGCCTGAGGGAATGGTTATA No data
Right 991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG No data
991950878_991950882 -10 Left 991950878 5:71945883-71945905 CCAGACCTCTCTGGACTGTCTGG No data
Right 991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG No data
991950877_991950882 -7 Left 991950877 5:71945880-71945902 CCTCCAGACCTCTCTGGACTGTC No data
Right 991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG No data
991950875_991950882 12 Left 991950875 5:71945861-71945883 CCTGAGGGAATGGTTATATCCTC No data
Right 991950882 5:71945896-71945918 GACTGTCTGGAGATTAGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991950882 Original CRISPR GACTGTCTGGAGATTAGGCT TGG Intergenic