ID: 991952517

View in Genome Browser
Species Human (GRCh38)
Location 5:71960349-71960371
Sequence TGTACCTCATGCACTGGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991952517_991952519 6 Left 991952517 5:71960349-71960371 CCAGTACCAGTGCATGAGGTACA No data
Right 991952519 5:71960378-71960400 GTAAACGTTGAGTCACTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991952517 Original CRISPR TGTACCTCATGCACTGGTAC TGG (reversed) Intergenic
No off target data available for this crispr