ID: 991955707

View in Genome Browser
Species Human (GRCh38)
Location 5:71994403-71994425
Sequence AGAGATTCAATTTAGCATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991955707_991955711 10 Left 991955707 5:71994403-71994425 CCAATATGCTAAATTGAATCTCT No data
Right 991955711 5:71994436-71994458 GTTCCCCCGATGGTCAAAAGTGG No data
991955707_991955709 0 Left 991955707 5:71994403-71994425 CCAATATGCTAAATTGAATCTCT No data
Right 991955709 5:71994426-71994448 ACCATCACAGGTTCCCCCGATGG No data
991955707_991955716 16 Left 991955707 5:71994403-71994425 CCAATATGCTAAATTGAATCTCT No data
Right 991955716 5:71994442-71994464 CCGATGGTCAAAAGTGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991955707 Original CRISPR AGAGATTCAATTTAGCATAT TGG (reversed) Intergenic