ID: 991955709

View in Genome Browser
Species Human (GRCh38)
Location 5:71994426-71994448
Sequence ACCATCACAGGTTCCCCCGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991955707_991955709 0 Left 991955707 5:71994403-71994425 CCAATATGCTAAATTGAATCTCT No data
Right 991955709 5:71994426-71994448 ACCATCACAGGTTCCCCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991955709 Original CRISPR ACCATCACAGGTTCCCCCGA TGG Intergenic