ID: 991957445

View in Genome Browser
Species Human (GRCh38)
Location 5:72009650-72009672
Sequence AATTGAGGGGCTTTAGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991957441_991957445 27 Left 991957441 5:72009600-72009622 CCTCTCGCATGCAGGCTGATGAG No data
Right 991957445 5:72009650-72009672 AATTGAGGGGCTTTAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991957445 Original CRISPR AATTGAGGGGCTTTAGCATA AGG Intergenic
No off target data available for this crispr