ID: 991958785

View in Genome Browser
Species Human (GRCh38)
Location 5:72021360-72021382
Sequence GTGTTGATTTTCTGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991958785_991958789 -5 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958789 5:72021378-72021400 AACACCCTACCTCTTTGTCAGGG No data
991958785_991958797 15 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958797 5:72021398-72021420 GGGTCCTGGGCTTGGGCTGATGG No data
991958785_991958792 1 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958792 5:72021384-72021406 CTACCTCTTTGTCAGGGTCCTGG No data
991958785_991958793 2 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958793 5:72021385-72021407 TACCTCTTTGTCAGGGTCCTGGG No data
991958785_991958795 7 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958795 5:72021390-72021412 CTTTGTCAGGGTCCTGGGCTTGG No data
991958785_991958788 -6 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958788 5:72021377-72021399 CAACACCCTACCTCTTTGTCAGG No data
991958785_991958796 8 Left 991958785 5:72021360-72021382 CCTTCCTGCCAGAAAATCAACAC No data
Right 991958796 5:72021391-72021413 TTTGTCAGGGTCCTGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991958785 Original CRISPR GTGTTGATTTTCTGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr