ID: 991963066

View in Genome Browser
Species Human (GRCh38)
Location 5:72064985-72065007
Sequence CCACATGCCTAGTCTCCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991963060_991963066 2 Left 991963060 5:72064960-72064982 CCCCAGAGCCAAGAGCAGGTGTA No data
Right 991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG No data
991963058_991963066 10 Left 991963058 5:72064952-72064974 CCTCAGAGCCCCAGAGCCAAGAG No data
Right 991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG No data
991963063_991963066 -6 Left 991963063 5:72064968-72064990 CCAAGAGCAGGTGTAAGCCACAT No data
Right 991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG No data
991963061_991963066 1 Left 991963061 5:72064961-72064983 CCCAGAGCCAAGAGCAGGTGTAA No data
Right 991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG No data
991963062_991963066 0 Left 991963062 5:72064962-72064984 CCAGAGCCAAGAGCAGGTGTAAG No data
Right 991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991963066 Original CRISPR CCACATGCCTAGTCTCCCCA GGG Intergenic
No off target data available for this crispr