ID: 991963417

View in Genome Browser
Species Human (GRCh38)
Location 5:72067875-72067897
Sequence AGCCCACGCCCTGCTCATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991963417_991963428 27 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963428 5:72067925-72067947 TCTCTGCTTGCTGGCTGGGTGGG No data
991963417_991963421 2 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963421 5:72067900-72067922 GACAGCCCTGGGTTTGCAACTGG No data
991963417_991963427 26 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963427 5:72067924-72067946 TTCTCTGCTTGCTGGCTGGGTGG No data
991963417_991963420 -9 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963420 5:72067889-72067911 GCGTGGGCTTGGACAGCCCTGGG No data
991963417_991963425 22 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963425 5:72067920-72067942 TGGCTTCTCTGCTTGCTGGCTGG No data
991963417_991963426 23 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963426 5:72067921-72067943 GGCTTCTCTGCTTGCTGGCTGGG No data
991963417_991963419 -10 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963419 5:72067888-72067910 GGCGTGGGCTTGGACAGCCCTGG No data
991963417_991963424 18 Left 991963417 5:72067875-72067897 CCTGTATGAGCAGGGCGTGGGCT No data
Right 991963424 5:72067916-72067938 CAACTGGCTTCTCTGCTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991963417 Original CRISPR AGCCCACGCCCTGCTCATAC AGG (reversed) Intergenic
No off target data available for this crispr