ID: 991964160

View in Genome Browser
Species Human (GRCh38)
Location 5:72074382-72074404
Sequence CTGAATAAGCAAGGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991964160_991964170 22 Left 991964160 5:72074382-72074404 CCTTCCTTCCCTTGCTTATTCAG No data
Right 991964170 5:72074427-72074449 AGCAGCTGGAGTTGGTGAACTGG No data
991964160_991964169 14 Left 991964160 5:72074382-72074404 CCTTCCTTCCCTTGCTTATTCAG No data
Right 991964169 5:72074419-72074441 TAGCAGGGAGCAGCTGGAGTTGG No data
991964160_991964164 -2 Left 991964160 5:72074382-72074404 CCTTCCTTCCCTTGCTTATTCAG No data
Right 991964164 5:72074403-72074425 AGCACCTTCTTCCTGATAGCAGG No data
991964160_991964167 8 Left 991964160 5:72074382-72074404 CCTTCCTTCCCTTGCTTATTCAG No data
Right 991964167 5:72074413-72074435 TCCTGATAGCAGGGAGCAGCTGG No data
991964160_991964165 -1 Left 991964160 5:72074382-72074404 CCTTCCTTCCCTTGCTTATTCAG No data
Right 991964165 5:72074404-72074426 GCACCTTCTTCCTGATAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991964160 Original CRISPR CTGAATAAGCAAGGGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr