ID: 991966334

View in Genome Browser
Species Human (GRCh38)
Location 5:72095105-72095127
Sequence AGAGTAAGGCCTATGAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991966326_991966334 3 Left 991966326 5:72095079-72095101 CCATATCTGCACTTCTTCCTCCC No data
Right 991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG No data
991966325_991966334 4 Left 991966325 5:72095078-72095100 CCCATATCTGCACTTCTTCCTCC No data
Right 991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG No data
991966324_991966334 20 Left 991966324 5:72095062-72095084 CCACTTTTTCTGGTTTCCCATAT No data
Right 991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG No data
991966323_991966334 27 Left 991966323 5:72095055-72095077 CCTTTCTCCACTTTTTCTGGTTT No data
Right 991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG No data
991966322_991966334 28 Left 991966322 5:72095054-72095076 CCCTTTCTCCACTTTTTCTGGTT No data
Right 991966334 5:72095105-72095127 AGAGTAAGGCCTATGAAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991966334 Original CRISPR AGAGTAAGGCCTATGAAGGG AGG Intergenic
No off target data available for this crispr