ID: 991970149

View in Genome Browser
Species Human (GRCh38)
Location 5:72133048-72133070
Sequence GGACCATGGACCCAGGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 297}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991970149_991970157 2 Left 991970149 5:72133048-72133070 CCTCCACCCTGGGTCCATGGTCC 0: 1
1: 0
2: 1
3: 30
4: 297
Right 991970157 5:72133073-72133095 GAGCAGCCATGCATCTGGCGTGG 0: 1
1: 0
2: 0
3: 6
4: 92
991970149_991970154 -3 Left 991970149 5:72133048-72133070 CCTCCACCCTGGGTCCATGGTCC 0: 1
1: 0
2: 1
3: 30
4: 297
Right 991970154 5:72133068-72133090 TCCCTGAGCAGCCATGCATCTGG 0: 1
1: 0
2: 0
3: 14
4: 149
991970149_991970160 15 Left 991970149 5:72133048-72133070 CCTCCACCCTGGGTCCATGGTCC 0: 1
1: 0
2: 1
3: 30
4: 297
Right 991970160 5:72133086-72133108 TCTGGCGTGGGATGCTAGCCTGG 0: 1
1: 0
2: 0
3: 9
4: 91
991970149_991970158 3 Left 991970149 5:72133048-72133070 CCTCCACCCTGGGTCCATGGTCC 0: 1
1: 0
2: 1
3: 30
4: 297
Right 991970158 5:72133074-72133096 AGCAGCCATGCATCTGGCGTGGG 0: 1
1: 0
2: 0
3: 9
4: 103
991970149_991970161 16 Left 991970149 5:72133048-72133070 CCTCCACCCTGGGTCCATGGTCC 0: 1
1: 0
2: 1
3: 30
4: 297
Right 991970161 5:72133087-72133109 CTGGCGTGGGATGCTAGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991970149 Original CRISPR GGACCATGGACCCAGGGTGG AGG (reversed) Intronic
900370373 1:2329523-2329545 GGGGCCTGGCCCCAGGGTGGGGG - Intronic
900478978 1:2889247-2889269 GGAGCGTGGTCACAGGGTGGGGG + Intergenic
901772432 1:11537177-11537199 GCACAGTGGATCCAGGGTGGGGG + Exonic
902142389 1:14367542-14367564 GGACCATGGTCCCAGGCTTGAGG + Intergenic
903303162 1:22393227-22393249 GGACCAGGCAAACAGGGTGGGGG + Intergenic
903806017 1:26006114-26006136 GGTCAGGGGACCCAGGGTGGGGG + Intergenic
903815376 1:26060777-26060799 GGCCCAGGGACCCAGGGAGAAGG + Intronic
904041707 1:27589112-27589134 TGGCCCTGGGCCCAGGGTGGGGG + Intronic
905104584 1:35557150-35557172 GGACCATGGGCTCAGGGGAGGGG - Intronic
905484725 1:38287201-38287223 GGAGGATGGACCCAGGGAAGAGG - Intergenic
905636793 1:39559422-39559444 TGACCCTGGACCCAGAGTGGTGG - Intergenic
906519514 1:46458867-46458889 GGACCCTGGTCCCTGGCTGGGGG + Intergenic
910721467 1:90291204-90291226 GGGTGATGGACCCATGGTGGTGG - Intergenic
910953935 1:92680975-92680997 GGACCCTGGACGGAGGGTGGGGG + Intronic
912273346 1:108231730-108231752 GGCCCATGGCCCCAGGGCTGGGG + Intronic
912294874 1:108462592-108462614 GGCCCATGGCCCCAGGGCTGGGG - Intronic
912748206 1:112263829-112263851 GGTCCATGGACCCAGGACAGTGG - Intergenic
916523580 1:165588274-165588296 GGACACTGGACCCAGTTTGGTGG - Intergenic
917534258 1:175863201-175863223 GGACCAGGGACAAAGGGCGGGGG - Intergenic
920293924 1:204944331-204944353 GCTGCATGGACCCAGGGCGGCGG - Exonic
922334379 1:224606824-224606846 GGACCCAGGACCAATGGTGGAGG + Intronic
923010240 1:230082865-230082887 GGAGCATGGAGCCAGGATGATGG + Intronic
923628598 1:235634601-235634623 GGAACAAGGAGCCAGGCTGGTGG - Intronic
924194144 1:241587365-241587387 AGGCCATGGACCGAGGGTTGGGG + Intronic
1062946112 10:1463339-1463361 GGACCAGGGACACAGGAGGGCGG - Intronic
1063617768 10:7616538-7616560 GGAACATGGACCAAGCGCGGTGG + Intronic
1063639624 10:7817096-7817118 GGAACAAACACCCAGGGTGGCGG + Intergenic
1064251066 10:13706917-13706939 GGAGCAGGGAGCGAGGGTGGGGG - Intronic
1064679604 10:17796777-17796799 GGACCATGGTCCAGGGGTTGGGG - Exonic
1065916819 10:30359860-30359882 GGACCATGAACTCAGCCTGGAGG + Intronic
1067145490 10:43690604-43690626 GGACCCTGCACCCAGAGTCGGGG + Intergenic
1067166447 10:43869572-43869594 GGACCACAGAGCCTGGGTGGTGG + Intergenic
1067532324 10:47083256-47083278 AGACCCTGGACCCAGGGTAGGGG - Intergenic
1067538453 10:47134589-47134611 TGACCAAGGACCCAAGTTGGAGG - Intergenic
1069585682 10:69599932-69599954 AGAACATGTACCCAAGGTGGTGG - Intergenic
1069602180 10:69715060-69715082 GGACAATGGCCACAGGGTGTTGG + Intergenic
1070707143 10:78647908-78647930 GGAGCATGAACACAGAGTGGAGG - Intergenic
1070736469 10:78866828-78866850 GAAGCACCGACCCAGGGTGGGGG + Intergenic
1070775889 10:79109585-79109607 GGATCAGGAACCCAGTGTGGGGG - Intronic
1073156887 10:101354323-101354345 GGACCCTGGGCCGAGGCTGGCGG + Intronic
1073525768 10:104180751-104180773 GGAGCATAGAAACAGGGTGGTGG - Intronic
1075566030 10:123504968-123504990 GGGCCAGAGTCCCAGGGTGGTGG + Intergenic
1076679183 10:132162956-132162978 GGACCCTGACCCCAGAGTGGGGG - Intronic
1076714556 10:132356754-132356776 GGGCCGTGGGCACAGGGTGGTGG + Intronic
1076766915 10:132640839-132640861 GGACCACGGACACTGTGTGGGGG - Intronic
1078608141 11:12795637-12795659 GGTCCATGGACCACAGGTGGAGG - Intronic
1079625565 11:22612740-22612762 AGGCCATGGACCAGGGGTGGGGG + Intergenic
1081667868 11:44927038-44927060 GGACCATGGAGCTGGGGCGGAGG - Intronic
1083228189 11:61297861-61297883 GGACCCTCCACCGAGGGTGGAGG + Intergenic
1084752419 11:71213006-71213028 GGAGCAGGGACCCCAGGTGGAGG + Intronic
1085027560 11:73245446-73245468 GGAGGATGGGACCAGGGTGGCGG + Intergenic
1089339715 11:117749160-117749182 GGACCAGGGAACCAGGGCAGAGG - Intronic
1089527688 11:119107737-119107759 GGAGCATGGATCCGGGCTGGGGG + Exonic
1089556152 11:119316900-119316922 GGATCGGGGACCCAGGGAGGAGG + Intronic
1089613446 11:119682120-119682142 GGTCCAAGGACTCAGGGTTGGGG + Intronic
1090831668 11:130424884-130424906 GGACATGAGACCCAGGGTGGAGG + Intronic
1091211249 11:133863593-133863615 GGTGCAGGGACCCTGGGTGGGGG + Intergenic
1091278235 11:134366837-134366859 GGAGCCAGTACCCAGGGTGGGGG + Intronic
1091291392 11:134442257-134442279 GGCAGATGGACCCAGGGTGTGGG + Intergenic
1091390578 12:123829-123851 GGAACAGGGGCCCAGGGTGGTGG - Intronic
1091687454 12:2573602-2573624 GGACCATGGGTCCTGGGTGAGGG - Intronic
1091699773 12:2651850-2651872 GGAGCAGGGCCCCAGAGTGGAGG - Intronic
1092590158 12:9945994-9946016 GGCCCATGGCCCGAGGGTTGGGG - Intergenic
1092903913 12:13085051-13085073 GGTCAAAGGACCCACGGTGGGGG + Exonic
1096476854 12:51913783-51913805 GGACCTGGGACACAGGGTGTAGG + Intronic
1098552191 12:71775048-71775070 AGATCATGATCCCAGGGTGGAGG + Intronic
1100390634 12:94143456-94143478 GGCGTATGGCCCCAGGGTGGGGG - Intergenic
1100875756 12:98959849-98959871 TCACCATGGACCTAGGGTAGTGG + Intronic
1101581692 12:106047636-106047658 GGACCATAGAGCCAGGGTGTTGG - Intergenic
1102013418 12:109632719-109632741 GGAACCTGGACCCAAGGGGGAGG + Intergenic
1102538437 12:113600176-113600198 GGGAGATGGAACCAGGGTGGGGG - Intergenic
1102619940 12:114186414-114186436 GGAACTGGGGCCCAGGGTGGTGG - Intergenic
1103957027 12:124582937-124582959 AGAACCTGGAGCCAGGGTGGGGG + Intergenic
1104860869 12:131922692-131922714 GGGCCATGGACCCATGCGGGGGG + Exonic
1104992576 12:132634456-132634478 GGCAGATGGACCCAGGTTGGAGG - Intronic
1105252410 13:18711336-18711358 GGGTGATGGACCCATGGTGGTGG + Intergenic
1105603468 13:21908085-21908107 GGACACTGGCCCCAGGGTCGAGG - Intergenic
1105837073 13:24221509-24221531 GGGCCATGGACCCAGGTGTGGGG + Intronic
1106235482 13:27857275-27857297 GGTCCATGGTCACAGGCTGGCGG + Intergenic
1107711079 13:43151225-43151247 GGACCAAGGACCAAGGGCCGAGG - Intergenic
1109698702 13:65996077-65996099 GGACAGTGGACCATGGGTGGAGG + Intergenic
1110757242 13:79189759-79189781 AGCCCATGGACCCAAAGTGGTGG + Intergenic
1111156825 13:84338353-84338375 GGTCCACGGACACAGGCTGGAGG + Intergenic
1111803218 13:93005680-93005702 ACACCATGCACCCAGGGTGTGGG - Intergenic
1112752495 13:102597023-102597045 TGGCCATGGACGCAGGATGGAGG - Exonic
1113744750 13:112736104-112736126 GGACCATGGTGCCAGGATGCGGG + Intronic
1113827467 13:113267920-113267942 TGACCATGGCCCTAGGCTGGAGG + Intergenic
1118347621 14:64951365-64951387 GGATCTTTGACCCAGGATGGAGG + Intronic
1119475231 14:74923097-74923119 GGTGCACGGTCCCAGGGTGGAGG + Intronic
1120149769 14:81020281-81020303 GGTTCATGGCCCCAGGGTTGGGG - Intronic
1120218423 14:81705274-81705296 GGGCCATGGATCCAGGCTTGAGG + Intergenic
1121087119 14:91155076-91155098 GGCCTGTGGACTCAGGGTGGAGG - Intronic
1121271491 14:92641028-92641050 GCACCAGGGACCCAGAGAGGTGG - Intronic
1121639628 14:95476358-95476380 TGCCCATGGACCCAGGTTGGTGG - Intergenic
1121650330 14:95553353-95553375 GGTCCTTACACCCAGGGTGGTGG - Intergenic
1122306754 14:100771310-100771332 GGCCCAGGGGCCCAGGCTGGGGG + Intergenic
1122595472 14:102887370-102887392 GGGCCAGGGACTCAGGGTAGAGG + Intronic
1122785413 14:104161185-104161207 GGACCCTGGACCCCAGCTGGAGG - Intronic
1122854393 14:104553217-104553239 GGAGCCTGGACTCAGGGTGGTGG + Intronic
1122882096 14:104694812-104694834 GGACCATGGAGCCTGGCTCGTGG + Intronic
1123119684 14:105910944-105910966 GGATCCTGGACCCAGGGGAGGGG + Intergenic
1125355998 15:38817967-38817989 GGACCAGGGACCCAGGTGTGAGG + Intergenic
1127335275 15:57978625-57978647 GGAGCAGGGCCCCTGGGTGGGGG + Intronic
1128110576 15:65073610-65073632 GGTCCATGGCCCCAGGGTTGGGG + Intronic
1128728738 15:70006560-70006582 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728745 15:70006581-70006603 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1128728752 15:70006602-70006624 GGGGCATGGACGCAGGGAGGTGG - Intergenic
1129386208 15:75197473-75197495 GGGCCTTGGACTCAGGGAGGGGG - Intronic
1129595213 15:76958450-76958472 TTTCCATGGACCCAGGGTTGTGG + Intergenic
1129701678 15:77771941-77771963 AGACCTTGGAGCCAGGCTGGAGG - Intronic
1129840047 15:78738287-78738309 GGACCATGAACTCAGCCTGGAGG - Intergenic
1130834938 15:87640817-87640839 CCAGCATGGACCCAGGCTGGGGG + Intergenic
1131849606 15:96524837-96524859 GAACAAGAGACCCAGGGTGGTGG + Intergenic
1132537452 16:489744-489766 GGCCCAGGGAACCTGGGTGGAGG + Intronic
1132576514 16:666823-666845 GCCCCAGGGATCCAGGGTGGTGG + Intronic
1133224197 16:4332837-4332859 GGTGCTTGGGCCCAGGGTGGTGG + Intronic
1133650324 16:7806731-7806753 GGTCCATGGCCCAAGGGTTGGGG - Intergenic
1133763061 16:8815304-8815326 GAACCAGGGAACCAGGGAGGTGG - Intronic
1134092335 16:11398293-11398315 GGACCAGGGACCCATGGTGAGGG - Intronic
1135565270 16:23506954-23506976 GGACACTGGACCCAGAATGGGGG + Intronic
1138525486 16:57603762-57603784 GGTCCATGGACCGGGGGTTGGGG - Intergenic
1139471333 16:67179591-67179613 GCACCCTGGCCCCAGGCTGGTGG - Intronic
1139779682 16:69340112-69340134 GCAGCATGGACCCAGGGGAGAGG + Intronic
1141254899 16:82391852-82391874 GGACAATGGCCCTGGGGTGGTGG + Intergenic
1141519244 16:84566697-84566719 GGGCTGTGGACACAGGGTGGCGG + Exonic
1141578581 16:84981769-84981791 GGGCCATGTACCTACGGTGGTGG + Intronic
1141825687 16:86478192-86478214 GGACAAGGGAAGCAGGGTGGAGG + Intergenic
1142647477 17:1324193-1324215 TGACCATGGAAGCAGGGCGGAGG - Intergenic
1143509420 17:7387261-7387283 AGACCCAGGGCCCAGGGTGGAGG - Intronic
1144627911 17:16854432-16854454 GGGCTGTGGACGCAGGGTGGCGG - Intergenic
1144945893 17:18969291-18969313 GGGCCCTGGCCCCAGGGAGGAGG - Exonic
1145159500 17:20565013-20565035 GGGCTGTGGACACAGGGTGGCGG - Intergenic
1145249994 17:21292030-21292052 GGAGCTGGGACCCAGGCTGGGGG + Intronic
1146010356 17:29189516-29189538 TTACCATGGACTAAGGGTGGGGG + Intergenic
1146436302 17:32851661-32851683 TTTCCATGGACCCAGGGGGGTGG + Intronic
1146560532 17:33865051-33865073 GGATAATGTATCCAGGGTGGAGG + Intronic
1146587343 17:34093708-34093730 TGGCCAAGGACCCATGGTGGGGG - Intronic
1146739077 17:35265420-35265442 TCACCAGGGACCCAGGGGGGAGG - Exonic
1147604022 17:41763786-41763808 GGCTCAGGGCCCCAGGGTGGTGG - Intronic
1148466148 17:47866404-47866426 GGAAGATGGGCCCAGGTTGGGGG + Intergenic
1148695136 17:49554195-49554217 GTACCATGGGCTCACGGTGGGGG + Intergenic
1148895801 17:50838322-50838344 GCTCCATGCAGCCAGGGTGGGGG + Intronic
1149095366 17:52833387-52833409 GTCCCCTGGACCCTGGGTGGTGG + Intergenic
1151322773 17:73361574-73361596 GGACCCTGGAAACAGAGTGGAGG - Intronic
1151425750 17:74030057-74030079 AGACCATGGACCCTGGGATGGGG - Intergenic
1154437283 18:14356896-14356918 GGTCCAGGGTCCCTGGGTGGGGG + Intergenic
1155422874 18:25674615-25674637 AGACCATGGTCCAGGGGTGGGGG - Intergenic
1155505423 18:26528299-26528321 GGAGGATGGTCCCAGGATGGTGG + Intronic
1156541463 18:37915827-37915849 GGCCTATGTACCCAAGGTGGAGG + Intergenic
1157501465 18:48193815-48193837 GGTCCAGGGACCCATCGTGGGGG + Intronic
1157580527 18:48771555-48771577 GGAAAATGAACCCTGGGTGGGGG - Intronic
1160265951 18:77340988-77341010 GGACCAAGTACCCTGGCTGGAGG - Intergenic
1161285044 19:3464395-3464417 GGGCCAGGGAGCCGGGGTGGGGG - Intronic
1161342617 19:3751401-3751423 GGCCCCTGGCCCCGGGGTGGGGG - Intronic
1161611932 19:5247990-5248012 GGGCCATGCACACAGAGTGGAGG + Intronic
1161814517 19:6491491-6491513 GGAGGATGGACCAAGTGTGGTGG + Intergenic
1161962171 19:7528981-7529003 GGACCTGGGGCCCAGGGTGTTGG - Intronic
1162417498 19:10546931-10546953 GCACCCTGGGCCCAGCGTGGGGG - Exonic
1162937276 19:13987452-13987474 TGACCAGGGACCCAGGGAGGTGG - Intronic
1164629657 19:29753883-29753905 GGTCCTTTGACCCAGGGAGGGGG - Intergenic
1166689174 19:44812562-44812584 GGACCTTGGCCCCAGGGTCCTGG + Intronic
1168421961 19:56210269-56210291 ACACCATGGACTCTGGGTGGTGG - Intergenic
1168427272 19:56248891-56248913 ACACCATGGACTCTGGGTGGTGG - Intronic
1168517365 19:57018737-57018759 GGACCCTGGAACGAGGGAGGTGG - Intergenic
925999785 2:9321441-9321463 GGACCAGGGATCCTGGGTGGGGG - Intronic
926593058 2:14760036-14760058 GGATCATGGTCCCAGGAGGGAGG + Intergenic
927640196 2:24841155-24841177 TGGCCATGGCCCCTGGGTGGGGG - Intronic
927971341 2:27307747-27307769 GGGGCACGGAACCAGGGTGGCGG - Exonic
928201781 2:29251837-29251859 GGCTCAGGGACCCAGGCTGGTGG + Intronic
929210396 2:39350720-39350742 GGAGGATGGACCTAGGGTGGAGG - Intronic
929558441 2:42940064-42940086 GGACTCTGGAGCCAGGCTGGCGG + Intergenic
929823115 2:45289412-45289434 AGACCATTGTTCCAGGGTGGAGG - Intergenic
934117654 2:88811958-88811980 GGGACATGGACCCAGGGCCGGGG - Intergenic
934606708 2:95700650-95700672 GATCCACGGAGCCAGGGTGGAGG - Intergenic
934663831 2:96156997-96157019 GGGCCATGGGCACAGGGTGGTGG - Intergenic
936540106 2:113342783-113342805 GAGCCACGGAGCCAGGGTGGAGG - Intergenic
936959436 2:118057765-118057787 GAATCATGGGCCAAGGGTGGAGG + Intergenic
937886324 2:126901976-126901998 GGCCCCAGGACCCAGGATGGAGG - Exonic
938250837 2:129814346-129814368 AGAACATGTGCCCAGGGTGGTGG + Intergenic
938735059 2:134178367-134178389 GGACTGTGGAGGCAGGGTGGTGG + Intronic
938963048 2:136360373-136360395 TTTCCATGGACCCAGGGAGGGGG + Intergenic
940658739 2:156520275-156520297 GGGCCATGGGCCCAGGCTTGTGG + Intronic
942349451 2:175037901-175037923 GGACACTGGACCTGGGGTGGAGG - Intergenic
943334487 2:186597628-186597650 GGTCCATGGCCCGAGGGTTGGGG - Intronic
943657754 2:190527653-190527675 GGTCCTTGGCCCCAGGGTTGGGG - Intronic
944302786 2:198143415-198143437 AGTCCATGGCCCCAGGGTTGGGG + Intronic
946203573 2:218086834-218086856 GGACCAAGGACCCAGGAGGAAGG + Intronic
947605765 2:231484131-231484153 GGCCCGCGGACCCAGCGTGGGGG + Intergenic
948198387 2:236112085-236112107 GTGGCAAGGACCCAGGGTGGGGG - Intronic
948711408 2:239827795-239827817 GGCCCGGGGCCCCAGGGTGGTGG - Intergenic
948858312 2:240740865-240740887 GTTCCAGGGCCCCAGGGTGGAGG - Intronic
948870387 2:240794978-240795000 GGGCCGTGGACTCAGGGTAGGGG - Intronic
948907590 2:240987109-240987131 GCGCCATGGAGCCAGGGTGTTGG + Intronic
1169140315 20:3224043-3224065 GCAGCATGGATCCAGGGTGGAGG - Intergenic
1170195863 20:13688983-13689005 GGTCCATGGCCCAGGGGTGGGGG - Intergenic
1170626626 20:18034966-18034988 GGACCCAGGACCCAGGGCCGAGG - Intronic
1172271053 20:33656152-33656174 GGCCCAGGGAGCCAGGCTGGTGG + Intergenic
1172442300 20:34974475-34974497 GGAAGATGCACCCTGGGTGGTGG + Intergenic
1174174285 20:48635288-48635310 GGACCCTTGAACCTGGGTGGTGG - Intronic
1174360630 20:50027036-50027058 TCAACATGGACACAGGGTGGGGG + Intergenic
1175739919 20:61413192-61413214 GGAGCATGGGCCAGGGGTGGGGG - Intronic
1177264398 21:18764711-18764733 GGTCCATGGGCACAGGCTGGAGG - Intergenic
1180050884 21:45330570-45330592 GGACCAGGGCCTCAGAGTGGAGG + Intergenic
1180050898 21:45330601-45330623 GGCCCAGGGCCTCAGGGTGGAGG + Intergenic
1180990098 22:19930549-19930571 TGACCATGGACCCTGGGGGAAGG + Intronic
1181343126 22:22198704-22198726 GGACCACAGACCCAGGAGGGTGG - Intergenic
1182278110 22:29202998-29203020 GGACCAGGCCCCCAGGGGGGAGG + Intergenic
1183286864 22:36971874-36971896 GGACCACGGGCCCTGGGTTGGGG + Intergenic
1183431097 22:37766172-37766194 GGCCCATGTGCCCAGGGAGGAGG - Intronic
1184158487 22:42684366-42684388 GGACCATAGGGCCAGGCTGGAGG + Intergenic
1185021425 22:48378858-48378880 GGAGCATCGTCCCAGGGCGGTGG - Intergenic
1185268835 22:49918989-49919011 GGACCCCGGATCCAGGGTGAGGG - Intronic
951224791 3:20108674-20108696 GGACCATGGCCCAGGGGTGGGGG - Intronic
951615121 3:24533682-24533704 GGACCATGGGCTAAGGATGGGGG - Intergenic
952886644 3:38016510-38016532 GGTCCATGGAGCCTGAGTGGTGG + Exonic
954800605 3:53184992-53185014 GGACCCTGGACACAGGGCAGTGG + Intronic
954952339 3:54486691-54486713 TGACCCTTGACCCAGGGTGCAGG + Intronic
955132025 3:56179554-56179576 GGACCATGGTAGCAGAGTGGAGG + Intronic
955416474 3:58696561-58696583 GGACCTTGGACCCAGTGTGGGGG - Intergenic
960471805 3:118075357-118075379 TCACAATGGACCCAGGGTGATGG - Intergenic
961752707 3:129106643-129106665 GGACCAGCGACACAGGCTGGCGG + Intronic
961863734 3:129938548-129938570 GGCCCATGGACACCTGGTGGTGG + Intergenic
964743236 3:159988766-159988788 AGGCCGGGGACCCAGGGTGGTGG + Exonic
968329976 3:197859927-197859949 GGACCATGAAGCCAGAATGGAGG - Intronic
968872173 4:3247680-3247702 TGACCAGGGACCCAGTGTAGGGG + Exonic
969090159 4:4688067-4688089 GGAGCGTGGAGCCAGGGAGGAGG - Intergenic
969471714 4:7392973-7392995 GGGCCAGGGAGCCAGGGTGCTGG - Intronic
969537437 4:7765353-7765375 GGACGAGGGGCACAGGGTGGTGG - Intronic
969600189 4:8171524-8171546 GGAGCAGGAACCCAGGCTGGCGG + Intergenic
969697453 4:8742758-8742780 GGCCCATGGCCCCGGGGTTGGGG + Intergenic
972173411 4:36375224-36375246 AGCCCATGGCCCCAGGGAGGAGG - Intergenic
972394004 4:38642189-38642211 AGACCATGGATCCAGGAAGGAGG - Intergenic
975428068 4:74253855-74253877 GGTCCATGGAGCCAGGCTGGTGG - Intronic
977734307 4:100394444-100394466 GGAGAATGGAACCAGGGAGGAGG - Intergenic
977962092 4:103097992-103098014 GGACCTTGGACCAAGTGTGGAGG - Intronic
978398793 4:108310102-108310124 GGGCCATGGTCCCAGGCTTGAGG - Intergenic
981117655 4:141010777-141010799 AGAAGATGGACCCAGGGAGGAGG + Intronic
982428307 4:155293243-155293265 AGACCATGTGCCCAGGGTGCTGG + Intergenic
982867979 4:160541715-160541737 GGCTCATGGACCAAGGGTTGGGG + Intergenic
984790809 4:183612881-183612903 AGCCCATGCACCCGGGGTGGGGG - Intergenic
985147841 4:186912692-186912714 TGACCACGGACCCTGGGTGGCGG + Intergenic
986123882 5:4867584-4867606 GGAGCCTGGCCCTAGGGTGGCGG + Intergenic
987128020 5:14833517-14833539 GGACCATATACCCAGACTGGGGG - Intronic
988521586 5:31950223-31950245 GGATCATGGGCCCAGGCTCGTGG - Intronic
988807383 5:34753104-34753126 GGACCAGAAGCCCAGGGTGGAGG + Intronic
988925981 5:35991413-35991435 GGAGCATGCACCCAGGGAGGAGG - Exonic
989672651 5:43936535-43936557 TCACCATGGACCTATGGTGGAGG + Intergenic
991207395 5:64065590-64065612 GGACCATGGGTCCAGGCTTGAGG - Intergenic
991970149 5:72133048-72133070 GGACCATGGACCCAGGGTGGAGG - Intronic
993307226 5:86288351-86288373 GGCCCATGGCCCCAGGGCTGGGG - Intergenic
995187874 5:109290463-109290485 GGACAATGGACCCGGGATGGAGG - Intergenic
996426615 5:123320174-123320196 GGACGATGGAGCCTGGCTGGGGG - Intergenic
997128258 5:131250559-131250581 GGACTGTGGAGCCAGGGTAGGGG + Intronic
998143679 5:139713492-139713514 GGCCCCTGAACCCTGGGTGGTGG + Intergenic
998312568 5:141150404-141150426 GGACCTGGGACTGAGGGTGGGGG + Exonic
998389142 5:141775857-141775879 TTTCCATGGACCCCGGGTGGGGG - Intergenic
998484050 5:142486395-142486417 AAACCATGATCCCAGGGTGGTGG - Intergenic
998879945 5:146635592-146635614 GGGCCACCAACCCAGGGTGGAGG - Intronic
999024187 5:148207416-148207438 GGAGCAGGGCCCCTGGGTGGGGG + Intronic
999538678 5:152548081-152548103 GGAGAATGGGCCCAGGGTGTGGG - Intergenic
1000652453 5:163833727-163833749 GGGCCATAGACCCAGCGTGGTGG - Intergenic
1001211244 5:169812079-169812101 AGGCCATGGACCCAGGGTTGAGG - Intronic
1001533428 5:172481116-172481138 AGTCCATGGCCCCAGGGTTGGGG - Intergenic
1001536956 5:172504817-172504839 GGACCAGGGCCCCAGGATGCTGG + Intergenic
1002468471 5:179420515-179420537 GGACAATGGCACCAGGGAGGGGG - Intergenic
1002594237 5:180311975-180311997 GGACCAGGGAGGCAGGGAGGTGG + Intronic
1002594287 5:180312103-180312125 GGACCAGGGAGGCAGGGAGGCGG + Intronic
1002636746 5:180612444-180612466 GGGCCAGGGACCCAGGGCAGGGG + Intronic
1003910836 6:10742256-10742278 GGACCATGAACCCACAGGGGAGG + Intergenic
1004699446 6:18065364-18065386 GGTCCACGGCCCCAGGGTTGGGG - Intergenic
1005862914 6:29915049-29915071 AGACTAGGGACCCAGTGTGGGGG - Intergenic
1005874423 6:30000245-30000267 AGACTAGGGACCCAGTGTGGGGG - Intergenic
1006444393 6:34070655-34070677 GGACCCAGGACCCAGGGCTGGGG + Intronic
1006606338 6:35259991-35260013 GGGGCAGGGACCCTGGGTGGGGG - Intronic
1007123412 6:39402330-39402352 GGCCCATAGACCCAGGATTGAGG - Intronic
1007151852 6:39701336-39701358 GGAACCTGGACCCAGATTGGTGG - Intronic
1007414429 6:41683621-41683643 GCACCCTGGGCCCGGGGTGGGGG - Intergenic
1007781524 6:44257393-44257415 GGACCATGGACGCCAGGTGGGGG - Exonic
1012062861 6:94511043-94511065 GGACCTCGGACCCACGGTGGAGG - Intergenic
1012954070 6:105549356-105549378 GGACAATGGAAACAGAGTGGAGG - Intergenic
1014434477 6:121406063-121406085 GGATCATGTTCCCAAGGTGGTGG - Intergenic
1014928016 6:127297908-127297930 GGAGCATGGACGCAAGGGGGAGG - Intronic
1015909905 6:138160565-138160587 GGAGCAAGGGCCCAGGGAGGAGG - Intergenic
1017633666 6:156423110-156423132 GGGCCATGGGCCCAGGCTTGTGG + Intergenic
1018848836 6:167573246-167573268 GGACCCTGTCCCCAGGTTGGAGG - Intergenic
1020911817 7:14140556-14140578 GATCCATGGCCCCAGGGTTGGGG + Intergenic
1021949650 7:25762136-25762158 GAACAATGGAGCCAGTGTGGAGG + Intergenic
1027251444 7:76401079-76401101 GGACCAGGGAGCCATGGTGTGGG - Intronic
1028288890 7:89041049-89041071 GCTCCATGGACCCAGGGTTCAGG - Intronic
1030066599 7:105664196-105664218 GGACCTGGGACCCAGTGTTGCGG + Intronic
1030963183 7:115952986-115953008 GGAGGATGGACCCAGGGAGGTGG - Intronic
1032766311 7:134997325-134997347 GGTCCATGGCCTCAGGGTTGGGG + Intronic
1033246440 7:139720355-139720377 GATCCATGGGCCCAGGGTGGAGG - Intronic
1033497106 7:141910120-141910142 GTCTCCTGGACCCAGGGTGGAGG + Intronic
1034579086 7:152026866-152026888 AGAGCATGTACCCAAGGTGGTGG - Intronic
1035535255 8:386163-386185 GGACCATGGAGGCAGCCTGGGGG - Intergenic
1036084489 8:5598964-5598986 GGTCAATGTGCCCAGGGTGGAGG + Intergenic
1036417516 8:8564317-8564339 GGGCCACGGAGCCAGGGAGGAGG + Intergenic
1037094164 8:14963489-14963511 GAACAATGTAGCCAGGGTGGTGG - Intronic
1037995894 8:23352232-23352254 GGCACAAGGACCCATGGTGGAGG - Intronic
1038046762 8:23772099-23772121 GGACAATGAAACCAGGGTGCTGG + Intergenic
1038424901 8:27458706-27458728 GGGCTATGGACACAGGGTGACGG + Exonic
1040522106 8:48186871-48186893 GCAACATGGACCCACAGTGGAGG - Intergenic
1043188265 8:77183152-77183174 GGAAAATGGAACCAGGGTTGTGG - Intergenic
1044018380 8:87074263-87074285 GGACCATGTTCCCAGGGGGAGGG - Intronic
1044558800 8:93592343-93592365 GAACAATGGACCCAGGCTGGCGG - Intergenic
1045891557 8:107164143-107164165 GGACCACGGCCTCAGGGTTGGGG - Intergenic
1046984294 8:120370377-120370399 GGCCAATGGAACCAGAGTGGAGG - Intronic
1048327728 8:133451981-133452003 GGATCAGGGAGCCAGCGTGGTGG + Intergenic
1049016598 8:139924441-139924463 GGTCCATGGGCCCAGGGAGTTGG - Intronic
1049475780 8:142796348-142796370 GGACCAAGGACACAGGATGTGGG + Intergenic
1049583022 8:143421279-143421301 GGACCATTACCCCAGCGTGGTGG - Intronic
1049644463 8:143729864-143729886 GAACAATGAACCCAGGCTGGTGG + Intronic
1050820087 9:9867858-9867880 AGACCTTGGCCCCAGGGTAGGGG + Intronic
1057253658 9:93525358-93525380 GGATCATGCACCTAGGATGGTGG - Intronic
1058321379 9:103636053-103636075 GGGCCATGGGTCCAGGTTGGAGG - Intergenic
1058646905 9:107139378-107139400 GGTCCATGGCCCCTGGGTTGGGG - Intergenic
1060464183 9:123887757-123887779 CGAGCATGCACACAGGGTGGAGG + Intronic
1060859188 9:126939850-126939872 AGGCCATGGACCCAGGCTGGAGG + Intronic
1060875104 9:127077563-127077585 GCACCTTGGTCCTAGGGTGGTGG - Intronic
1062137696 9:134938375-134938397 GGCCTACGGACCCAGGGAGGGGG + Intergenic
1062283301 9:135761622-135761644 GGACCAGGGACGGAGGCTGGGGG - Intronic
1062474533 9:136720545-136720567 GGCCCCTGGAGCTAGGGTGGGGG + Intronic
1185683288 X:1906628-1906650 GGACCATGGGCCCAGGCTTGAGG + Intergenic
1188526607 X:31094389-31094411 GGACCATGGGTCCAGGCTTGAGG + Intergenic
1190316999 X:49157433-49157455 AGACCCTGGAAACAGGGTGGCGG + Intergenic
1191109323 X:56792908-56792930 GGACCCTGCAACCAGGGTAGGGG + Intergenic
1195647608 X:107250040-107250062 GGGCCATGGATCCAGGCTTGAGG + Intergenic
1201934036 Y:19386642-19386664 GGCCCAAGGACCCAGGGGTGTGG + Intergenic