ID: 991971580

View in Genome Browser
Species Human (GRCh38)
Location 5:72146840-72146862
Sequence ATAGCATCAGCCTCTTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991971577_991971580 7 Left 991971577 5:72146810-72146832 CCATGTACAGGAAGTATGTGCTT 0: 1
1: 0
2: 0
3: 14
4: 150
Right 991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG 0: 1
1: 1
2: 1
3: 16
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991971580 Original CRISPR ATAGCATCAGCCTCTTTCTG GGG Intronic
902674202 1:17997167-17997189 ACAGCTTCAGCCACATTCTGGGG + Intergenic
903235090 1:21944923-21944945 ATAGCATGAGCGTCTCTCTCTGG + Intergenic
903266841 1:22162902-22162924 AGAGCTTCATCCACTTTCTGAGG - Intergenic
904195544 1:28782632-28782654 ATGGCATCAGCCTCCTTCCCAGG + Intergenic
906859512 1:49343645-49343667 ATAGCATTCCCCTCTTTTTGGGG + Intronic
906889602 1:49694441-49694463 CTTTTATCAGCCTCTTTCTGTGG - Intronic
909254477 1:73401789-73401811 ATAGCATCAGCCTCCTGCTCAGG - Intergenic
909430410 1:75581903-75581925 ATGGCATCAGCCTCTGTTTTTGG - Intronic
914807241 1:151000599-151000621 ATTGCATCATCCACATTCTGGGG + Exonic
915795496 1:158728913-158728935 AATGCATCAGCCTATTTTTGTGG - Intergenic
918535094 1:185565160-185565182 ATGCCATCAGCCTTTATCTGAGG - Intergenic
920346191 1:205307130-205307152 ATGGCCTCAGCCTCTAACTGAGG - Intronic
922338694 1:224638348-224638370 CCAGCATCAGCCTTTTTCAGGGG + Intronic
924295470 1:242582699-242582721 GTTGCATCTGCCTATTTCTGTGG + Intergenic
1062991888 10:1827069-1827091 AGAGAATCAGCCTCTTGGTGGGG - Intergenic
1065077752 10:22098136-22098158 TAAGCATCACCTTCTTTCTGGGG - Intergenic
1066530367 10:36331563-36331585 GTAGCATCTGCCAGTTTCTGAGG + Intergenic
1067032203 10:42885594-42885616 ATATCACCATCCTCTTTCAGTGG - Intergenic
1067283385 10:44890102-44890124 ATAGCATTTGCCAATTTCTGTGG - Intergenic
1068310268 10:55265928-55265950 AAAGCTTCTGCCTCTTTCTTGGG - Intronic
1069775419 10:70924382-70924404 GTAGCATCAGCCAATTTCTGTGG - Intergenic
1074208755 10:111308555-111308577 ATAGCATCACCCTTCTTCTGGGG + Intergenic
1074735027 10:116422190-116422212 ATGTCATCAGCCTCATTGTGAGG + Intergenic
1075759222 10:124842773-124842795 ATTGCATCAAACTCTTTCAGTGG + Intergenic
1075960381 10:126563079-126563101 GTAGCATTTGCCACTTTCTGTGG - Intronic
1076261857 10:129072819-129072841 CTACCATCAGCCTTTTTCTCTGG - Intergenic
1077869081 11:6246431-6246453 ATAGCATCAGTTGCTTTCTGAGG + Intergenic
1079348710 11:19674808-19674830 ATAGCTACTGCCTCTTACTGTGG - Intronic
1079420364 11:20280766-20280788 ATAGCATCAGCCTTCTTCCATGG + Intergenic
1081004378 11:37716566-37716588 ATAGCAACAGCATCTTTTAGGGG - Intergenic
1083209111 11:61171638-61171660 ATAAGTTCTGCCTCTTTCTGTGG + Intergenic
1083695095 11:64437342-64437364 ATAGCATGTGCCATTTTCTGTGG - Intergenic
1084170934 11:67400834-67400856 AGAGCAACTACCTCTTTCTGGGG - Exonic
1087912019 11:103764952-103764974 ATGGCATCTGCCTCTCTCTCAGG - Intergenic
1089582768 11:119491804-119491826 CTATCATCAGCTTCTTTCTCAGG + Intergenic
1090773871 11:129946504-129946526 AAACCATCAGTTTCTTTCTGTGG - Intronic
1091851843 12:3705897-3705919 GTAGCATCTGCCTATCTCTGTGG + Intronic
1092313735 12:7387674-7387696 ATGGCATCAGCCTCTGCCTCTGG - Intronic
1093985295 12:25524419-25524441 ATAGAATCAGACCATTTCTGTGG - Intronic
1094179395 12:27575853-27575875 ATAGCTTAAGTCTGTTTCTGAGG + Intronic
1098936881 12:76490477-76490499 ACGCCATCAGGCTCTTTCTGAGG - Intronic
1099327495 12:81237668-81237690 ATAGCTTTACCCACTTTCTGTGG + Intronic
1099336445 12:81365758-81365780 ATAGTATCTGATTCTTTCTGAGG - Intronic
1100330904 12:93581219-93581241 ATAGCATCTGCCTATTTCTGTGG - Intronic
1100408019 12:94287916-94287938 ATACTATCAGCCCCATTCTGAGG + Intronic
1102045657 12:109828583-109828605 AGAGCTTAAGCCACTTTCTGAGG + Intronic
1105400514 13:20090179-20090201 ATGGCATCAGTCCTTTTCTGTGG + Exonic
1105776808 13:23669958-23669980 AGAGCAGCAACCTCTTTGTGGGG - Intronic
1107442545 13:40440963-40440985 ATCGCAACAGCCTCCTCCTGAGG + Intergenic
1108221184 13:48234159-48234181 ATTGTATCAGCGTCTTTGTGAGG + Intronic
1109289137 13:60452023-60452045 ATAGCATTTGCCACTTTCTATGG + Intronic
1113117869 13:106892687-106892709 AGGGCATGCGCCTCTTTCTGCGG + Intergenic
1113138727 13:107122879-107122901 ATTGCAACTGCCTCTTTTTGAGG - Intergenic
1113226762 13:108168206-108168228 CTAGATTCAGCCTCTTTCTTAGG - Intergenic
1113764964 13:112875356-112875378 TTTGAATCATCCTCTTTCTGGGG + Intronic
1114362474 14:21990219-21990241 ATAGCATCACACTTTTACTGAGG + Intergenic
1114726573 14:24944088-24944110 ATAGCCTGAGCCTCTTCTTGTGG - Intronic
1115691045 14:35844164-35844186 ATGGCTTCAGCCTCTTTTCGAGG + Intronic
1115834046 14:37377492-37377514 ATATCATCAGCAACTTTTTGGGG + Intronic
1116947144 14:50846500-50846522 GTAGCATCAGCCTATGGCTGAGG - Intergenic
1117805920 14:59490605-59490627 ATAGAATCAGCAGTTTTCTGGGG + Intronic
1117874089 14:60233493-60233515 ATAGCATGAGCCATTTTCTTAGG + Intergenic
1119646849 14:76354415-76354437 ATAGCAGCAGCCTTTTTCCAGGG + Intronic
1120956545 14:90088364-90088386 ATAGCATTTGCCTATTTCTGTGG + Intronic
1121927712 14:97944097-97944119 GTGGCATTAGCCTCTGTCTGTGG + Intronic
1122906857 14:104805568-104805590 ATAGCAACAGCCTCCTCCTCTGG - Intergenic
1123913823 15:25000033-25000055 ACAGTATCAGCATCTTTCTGTGG - Intergenic
1124237865 15:28005192-28005214 ATGGAATCAGCCTCCTTCTGAGG - Intronic
1124616893 15:31248567-31248589 ATAGGCTCAGCCTCTCTCTGGGG + Intergenic
1127886049 15:63201933-63201955 ATAGGACCAGCCCCTTTCAGTGG + Intronic
1127959072 15:63877719-63877741 ATATCATGAGCATCTTTCTAAGG + Intergenic
1132025204 15:98399337-98399359 TGAGCATCACCCTCTTCCTGAGG + Intergenic
1133732140 16:8587087-8587109 GTAGCATTTGCCTATTTCTGTGG - Intronic
1137065804 16:35841923-35841945 AGAGCATCAATCTCTTTATGAGG + Intergenic
1138625033 16:58244770-58244792 ATGCCTCCAGCCTCTTTCTGTGG + Intronic
1139030325 16:62873201-62873223 ACAGCATCAGCCATTTTCAGGGG - Intergenic
1139228606 16:65258246-65258268 ATAGCTTCTGCCTCTCTATGTGG + Intergenic
1139544943 16:67645672-67645694 AGAGCAAGAGGCTCTTTCTGTGG - Intronic
1139695059 16:68668244-68668266 CTTGCATCAAACTCTTTCTGGGG - Intronic
1141322267 16:83022517-83022539 GTAGCATCTGCCGATTTCTGTGG - Intronic
1144263315 17:13544544-13544566 ACAGCCCCAGCCTCTTTGTGTGG + Intronic
1144838842 17:18173208-18173230 TTAGCAAGAGCTTCTTTCTGAGG + Intronic
1148133215 17:45274677-45274699 ACAGCAGCAGCCTCTGTGTGTGG - Intronic
1149668630 17:58384974-58384996 GTAGCATCAGTCCCTTTCTTAGG - Intronic
1150226484 17:63527335-63527357 GTAGCACCAGCCTCTCCCTGGGG + Intronic
1150557927 17:66270064-66270086 ATATCATCAACCTCTATCTCTGG + Intergenic
1150846314 17:68662214-68662236 TTAGCATCAGAATCTTTCCGCGG - Intergenic
1150879646 17:69009406-69009428 AGAACATCAGCCTCTTTCCACGG - Intronic
1151157235 17:72133812-72133834 ACACCTCCAGCCTCTTTCTGTGG + Intergenic
1151245850 17:72794049-72794071 TTAGCATCAGGCTCTGCCTGAGG + Intronic
1153512113 18:5867128-5867150 ATAGGATCAGCCTGTGTCCGAGG - Intergenic
1154365411 18:13703461-13703483 ATAGTATCTCCCTCTTTCAGGGG + Intronic
1158056030 18:53281730-53281752 ATAGCATCTGCCAATTTCTGTGG - Intronic
1158121444 18:54052788-54052810 ATAGCCTCAGTCTATATCTGAGG + Intergenic
1159462588 18:68739755-68739777 TTAGCCACAGCCTCTTGCTGGGG + Intronic
1163084959 19:14972878-14972900 ATGGCAACAGCCTGTTCCTGCGG - Exonic
1168060276 19:53888071-53888093 AGAACAGCAGCCTCTGTCTGTGG + Intronic
928374214 2:30761915-30761937 AGAGCATCAGGCTCTATGTGTGG - Intronic
928402437 2:30988684-30988706 AGAGCATCAGCCTGTACCTGTGG - Intronic
928451230 2:31380216-31380238 ATAGCATTTGCCAATTTCTGTGG + Intronic
931982886 2:67713028-67713050 ATAACATCAACATCTTTCAGTGG + Intergenic
934087852 2:88525263-88525285 ATAGCATCTGCCAATTTCTGTGG - Intronic
939903452 2:147879824-147879846 ATAGCAACAGCCTCTTTAACTGG - Intronic
940394129 2:153167758-153167780 ATAGAAGCAGCCTTTTTCTAAGG - Intergenic
941066258 2:160906319-160906341 ACAGCATCAGCCTCATTGAGAGG - Intergenic
941606926 2:167609505-167609527 AGAGCATCATCCTCATCCTGAGG + Intergenic
941704545 2:168644040-168644062 ATAGCATAAAAATCTTTCTGTGG + Intronic
942448730 2:176095601-176095623 ATTGATTCAGCCTCTTTTTGAGG - Exonic
943227491 2:185197183-185197205 ATACCAACAGACTATTTCTGTGG - Intergenic
943663270 2:190581918-190581940 ATAGCATTTGCCTATTTTTGTGG - Intergenic
945246921 2:207726970-207726992 TTAGTATGAGCCTCTTTTTGTGG + Intronic
945724754 2:213462857-213462879 ATAGCAGCACCCACTCTCTGTGG - Intronic
946079783 2:217107605-217107627 ATAGCAGCAGCCTCTTTCTGTGG - Intergenic
947946851 2:234111230-234111252 ATGGCATCAGCTTCTAGCTGTGG + Intergenic
1169768918 20:9180365-9180387 GTAGAATCAGCCTCTTGATGGGG + Intronic
1170214515 20:13877154-13877176 ATAACAGCAGCCTTTATCTGGGG - Intronic
1170425941 20:16235735-16235757 ATAGCTTCAGCCTAATGCTGCGG + Intergenic
1170579652 20:17688182-17688204 ACAGCATCTGCCAATTTCTGTGG + Intergenic
1173173860 20:40749333-40749355 ATAGCATGTGCCTATTTCTTTGG - Intergenic
1173939943 20:46902093-46902115 ATAGAATCAGGCTTTTTTTGAGG + Intronic
1177815039 21:25967167-25967189 ATAGCATCGGCATCCTTCTTTGG - Intronic
1178432648 21:32530015-32530037 GTAGCATCTGCCAATTTCTGTGG + Intergenic
1178899180 21:36585356-36585378 CTAGCATCTGCCCATTTCTGTGG + Intergenic
1179381699 21:40905335-40905357 ACACCATCTGCATCTTTCTGGGG + Intergenic
1180165972 21:46029125-46029147 ATATCATCATCATCTTTATGGGG - Intergenic
1181980171 22:26760516-26760538 ACAACATCAGCCTCCATCTGGGG - Intergenic
1182779362 22:32855375-32855397 ATAGCATTTGCCTGCTTCTGGGG + Intronic
950028339 3:9835473-9835495 ATGGCCTCAGGCTCTTGCTGTGG - Exonic
950298214 3:11850320-11850342 GTTGCTTCTGCCTCTTTCTGGGG - Intergenic
953807179 3:46080691-46080713 ACATCATAAGCCTGTTTCTGGGG - Intergenic
954421040 3:50419135-50419157 AAAGCCTAAGCCTCTTTCCGTGG - Intronic
954569797 3:51631194-51631216 ATAATTTGAGCCTCTTTCTGTGG + Intronic
962166588 3:133055634-133055656 AGAGGAGCTGCCTCTTTCTGTGG - Intronic
963101444 3:141609909-141609931 TAATCATCAGGCTCTTTCTGTGG - Exonic
963174536 3:142283953-142283975 GTAGCATCTCCCTCATTCTGGGG + Intergenic
966866001 3:184259641-184259663 CCAGCCTCAGCCTCTTTCTAAGG - Exonic
967115527 3:186334121-186334143 ACAGCAGCAGCCGCTTACTGAGG + Intronic
968042269 3:195598744-195598766 AGAGGACCAGCCTCCTTCTGAGG - Intergenic
968222916 3:196951680-196951702 AGAGCAGCAGCCTCTCTCTCTGG - Intronic
970454120 4:16205085-16205107 AAAACGCCAGCCTCTTTCTGTGG + Intronic
971444922 4:26732909-26732931 ATGGCATCAGCCTCGTAGTGAGG + Intronic
972175951 4:36406590-36406612 ATATCATCAGTCTATTTCTTGGG + Intergenic
975315457 4:72946958-72946980 AAAGTATCAGTCTCTTCCTGAGG + Intergenic
975779659 4:77824875-77824897 ATTGCCTCTGCCCCTTTCTGGGG + Intergenic
975993051 4:80280753-80280775 ATAGCATGACTTTCTTTCTGAGG - Intronic
977907779 4:102498430-102498452 ATAGCATCAATCTATTTGTGAGG - Intergenic
979996984 4:127443132-127443154 ATAAAAACAGCCACTTTCTGAGG + Intergenic
980118128 4:128700663-128700685 ATAGCATTTGCCTGTTTCTGTGG + Intergenic
985898673 5:2767437-2767459 ATAGCATCAGCCTCTCTGCCTGG + Intergenic
986318578 5:6609054-6609076 AGAGCTCCAGCCTTTTTCTGGGG - Intronic
987646593 5:20680323-20680345 ACAGCTTTAGCCTCTTTCTCAGG + Intergenic
990930671 5:61087256-61087278 GTATAATCAGCTTCTTTCTGGGG - Intronic
991971580 5:72146840-72146862 ATAGCATCAGCCTCTTTCTGGGG + Intronic
992693709 5:79263751-79263773 ACAGCATCAGCCTCCTGCTTTGG + Intronic
993280570 5:85920423-85920445 ATAGATTCAGCCCCTTTCTTGGG - Intergenic
994467887 5:100162132-100162154 ATAGCATTTCCCTCTTTTTGGGG - Intergenic
994889802 5:105619005-105619027 ATAGCATCACCCCATTTCTCTGG - Intergenic
995128752 5:108607629-108607651 ATTGCAGCAGCCTGTTGCTGAGG - Intergenic
995471204 5:112503755-112503777 ATGGCTTCAGCCCCTTTCAGGGG - Intergenic
995701200 5:114937886-114937908 TTAACATCAGCCTCTTACAGTGG + Intergenic
996476477 5:123928333-123928355 ATAGCATCTTCCTCCTTTTGAGG - Intergenic
997122908 5:131194768-131194790 TTATCATTAGCCTATTTCTGTGG + Intronic
997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG + Exonic
997613230 5:135229656-135229678 CATTCATCAGCCTCTTTCTGTGG + Intronic
998288649 5:140890160-140890182 GTAGCATTTGCCTATTTCTGTGG - Intronic
999382098 5:151128432-151128454 ATAGCATTTGCCTATTTCTGTGG + Intronic
1000999662 5:167993939-167993961 TCAGCATCTGCCACTTTCTGTGG - Intronic
1001044039 5:168357638-168357660 ATTGTATCTGCCTCTTTCTAGGG + Intronic
1004765688 6:18723598-18723620 ATAGCATTTCCCTCTTTTTGGGG + Intergenic
1006101693 6:31689670-31689692 ATGGCATTAGCCTCATTCTGCGG + Exonic
1007337157 6:41162156-41162178 AGAGCACCAGCCTGTTGCTGGGG + Intronic
1007720261 6:43880958-43880980 ATAGCTCCAGCCTGGTTCTGGGG + Intergenic
1009802690 6:68561157-68561179 ATATCATATGCCTCTTTCTAGGG + Intergenic
1014558250 6:122859328-122859350 ATACCATCAGCATCTTTCCAGGG - Intergenic
1015590737 6:134820725-134820747 ATAGGAACAGCCTATTTGTGAGG - Intergenic
1017332836 6:153219583-153219605 ATAACATTTGCCTATTTCTGTGG - Intergenic
1019062385 6:169265762-169265784 ATAGCATTAGCCCCCGTCTGAGG + Intergenic
1022001793 7:26233123-26233145 AAAGCAACAGCCTCTTTATCTGG + Intergenic
1022389254 7:29929131-29929153 GCAGCATCAGCCTCTTTCACTGG + Intronic
1023279909 7:38558716-38558738 CCAGCATCAGCGTCTTTCTAAGG - Intronic
1024703517 7:51930468-51930490 ATAGACTCAGCCTCCTTCAGTGG + Intergenic
1026262986 7:68771817-68771839 ATAGTATCATCCTCATTTTGAGG + Intergenic
1030653991 7:112146209-112146231 ATCGAATCAGCCTTTTTCTAAGG + Intronic
1033557165 7:142498983-142499005 ATAGCAACAGCCTCACTCTCAGG - Intergenic
1034884180 7:154785067-154785089 ATAGGTTCAGCCTCATTCAGAGG + Intronic
1034919604 7:155069445-155069467 ATATCATGTGCCTCTTTATGAGG + Intronic
1039144060 8:34425665-34425687 ATTGTATCAGCATCTTTCTGAGG + Intergenic
1040765827 8:50909884-50909906 ATAGCATCAGCCTCCTTGCCTGG - Intergenic
1041746842 8:61216455-61216477 ACAGCATCTTCATCTTTCTGAGG - Intronic
1044739292 8:95309338-95309360 ACAGCAGCAAGCTCTTTCTGGGG - Intergenic
1044839047 8:96322530-96322552 ATAGCATCAGTCCATTTATGGGG + Intronic
1045249261 8:100469542-100469564 ATGACATCACCCTCTTGCTGTGG + Intergenic
1045370409 8:101516996-101517018 ACAGCATCATCCTGTTCCTGTGG + Intronic
1045613162 8:103872093-103872115 ACTGCATTAGCCTGTTTCTGTGG + Intronic
1045656078 8:104387889-104387911 AAAGCACCTGCCTATTTCTGTGG + Intronic
1047460692 8:125061868-125061890 TGAGCATCAGCCTCTTTATCTGG - Intronic
1048177161 8:132163251-132163273 ATGGCAGCAGCCTCTTATTGAGG - Intronic
1048184325 8:132225684-132225706 ATAGCATTTGCCACTTTCTGTGG - Intronic
1049742902 8:144249562-144249584 ATAGCATGAGCCTCACTCTGGGG - Intronic
1049969325 9:807708-807730 AAAGCTTCAGCCCCTTTCTTGGG + Intergenic
1057058343 9:91981236-91981258 ATAGGATCCCCCTCTTTCAGCGG - Intergenic
1057989585 9:99754415-99754437 AGAGCAAAAGCCTATTTCTGTGG + Intergenic
1059799438 9:117735409-117735431 ATATCATGAGACTCATTCTGAGG + Intergenic
1060451071 9:123740829-123740851 ATGGCATCACCTACTTTCTGCGG + Intronic
1061705141 9:132447288-132447310 TTAGAACCTGCCTCTTTCTGGGG + Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062150374 9:135015258-135015280 CTGGCATCTGCTTCTTTCTGAGG + Intergenic
1062322385 9:135996760-135996782 ACAGCACCAGCCTCTGTGTGGGG + Intergenic
1185928789 X:4177145-4177167 TTAGCATCAAAGTCTTTCTGTGG + Intergenic
1186728853 X:12386257-12386279 AAAGCAACAACCTATTTCTGTGG + Intronic
1189664438 X:43338878-43338900 ATAGCATCAGCCTTCTTGCGTGG - Intergenic
1191648575 X:63510400-63510422 ATAACATAAGCCCATTTCTGGGG - Intergenic
1193764816 X:85514427-85514449 ATAGCATCTGCTTCTCTCTTAGG + Intergenic
1195555650 X:106219427-106219449 AGAGCATATTCCTCTTTCTGTGG + Intergenic
1195868610 X:109461665-109461687 GTAGCATTTGCCTGTTTCTGCGG + Intronic
1197137571 X:123081006-123081028 ATACCATCAGCCTTTGTCTTAGG + Intergenic
1198661784 X:138976903-138976925 ATAACTTCAGCAGCTTTCTGTGG - Intronic
1198811474 X:140540438-140540460 ACAGCATGGGCCTCTCTCTGGGG - Intergenic
1199545960 X:149007665-149007687 GTAGCATCAGACTCTTGATGGGG + Intergenic
1200334199 X:155331583-155331605 ATAGCATCATCCTATTTGTAAGG - Intronic
1201607252 Y:15800510-15800532 ATACCCTCAACATCTTTCTGTGG + Intergenic