ID: 991971767

View in Genome Browser
Species Human (GRCh38)
Location 5:72148349-72148371
Sequence CTGGGTATGGGCCCTTCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991971767_991971775 3 Left 991971767 5:72148349-72148371 CCCACAGAAGGGCCCATACCCAG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 991971775 5:72148375-72148397 GATCTTTGCTGAGAGCATCTAGG 0: 1
1: 0
2: 0
3: 15
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991971767 Original CRISPR CTGGGTATGGGCCCTTCTGT GGG (reversed) Intronic
900317760 1:2067956-2067978 CTGGGACGGGGCCCTTCTCTTGG + Intronic
903324309 1:22561086-22561108 CTGGGTTTTGCCCATTCTGTAGG - Intergenic
903858590 1:26351921-26351943 CTGGGAATGGCCCCTTCTGCTGG - Intronic
904539374 1:31222494-31222516 CAGGGTATGGACCCATCTGGGGG + Intronic
906023512 1:42652904-42652926 CTGGGTATGGGCTTTTTTGGGGG + Intronic
906148634 1:43575060-43575082 CTGGACCTGGGCCCATCTGTGGG + Intronic
906552355 1:46675631-46675653 CTGGCCATTGTCCCTTCTGTTGG - Exonic
908675269 1:66596374-66596396 CTGGGTCTGGGACCTTTTATGGG + Intronic
909395334 1:75165550-75165572 CTGTGTATGGGCACTTGTATGGG + Intergenic
909863640 1:80638151-80638173 CTGAGGATGGCCCCTTCTGCTGG + Intergenic
912691976 1:111811493-111811515 CTGGGTGTGGGCTCAGCTGTGGG + Intronic
913024031 1:114817453-114817475 TTGGGTATGGGCTTTCCTGTTGG - Intergenic
913359248 1:117961422-117961444 CTGGGTCTGGGCTTTTCTTTTGG + Exonic
913495635 1:119425881-119425903 CCCGGTATGGGCCCTTCCATCGG + Intergenic
914826790 1:151142957-151142979 CTGGGTCTGGGACATTCAGTAGG + Intronic
915221557 1:154379130-154379152 CACGGTATGGACCCCTCTGTAGG + Intergenic
916007488 1:160675482-160675504 CTTGGATTGGGCCCTTGTGTTGG - Intergenic
917312138 1:173689371-173689393 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
918242738 1:182634681-182634703 CTGTGTATGGGACCTTAGGTGGG + Intergenic
918421469 1:184368234-184368256 GTTGGTATGGGTCCTTCTGAGGG - Intergenic
918793247 1:188858069-188858091 CTGCCTATGGCCCCTGCTGTGGG + Intergenic
920044052 1:203122166-203122188 CTGGGGCTGAGGCCTTCTGTGGG + Intronic
920176265 1:204103875-204103897 CTCGGTTTGGGACCTTCTGGAGG + Intronic
921872223 1:220153321-220153343 GTGGGTGTGGCCTCTTCTGTGGG + Exonic
923913888 1:238481623-238481645 CTGAGGATGGCCCCTTCTGCGGG - Intergenic
1064032405 10:11891260-11891282 CTGGGTCTGGGCTGTGCTGTGGG - Intergenic
1067053578 10:43038821-43038843 CTGGGTGTGGGCCTCTCTGAGGG - Intergenic
1068856013 10:61798188-61798210 ATGGCTGTGGGCCCTGCTGTGGG + Intergenic
1070992086 10:80741467-80741489 CTGGATTTGGGGCCATCTGTTGG - Intergenic
1071283440 10:84123783-84123805 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
1071528686 10:86373172-86373194 CTGGGGAAGGGGCTTTCTGTTGG - Intergenic
1072088196 10:92101036-92101058 CTCTGTATGGTCCCTTCTTTAGG + Intronic
1073142908 10:101260982-101261004 CGGGGTTTGGGCCCCTCTATCGG - Intergenic
1075339388 10:121633304-121633326 CTGGGTCTGGGCTCTGGTGTTGG - Intergenic
1076883717 10:133251922-133251944 CTGGGCAGGGGCCCTGCTGTGGG + Intergenic
1077057030 11:598841-598863 CTGGGCCTGGGCTTTTCTGTGGG + Intronic
1077151585 11:1075307-1075329 CTGAGAATGGGGCCTTCTGGTGG - Intergenic
1078436240 11:11328069-11328091 CTGGGCATGGGGGGTTCTGTTGG + Intronic
1083560307 11:63668338-63668360 CTGGGTGTGGTTCCTTCTGGTGG + Intronic
1083654536 11:64223183-64223205 CTGGGTCTGGGCCCACCTGCCGG - Exonic
1083888048 11:65582239-65582261 CTGGAGCAGGGCCCTTCTGTTGG + Exonic
1085281501 11:75334029-75334051 CCTGGGATGGGACCTTCTGTGGG - Intronic
1085452974 11:76648029-76648051 CTGGCTGAGGGTCCTTCTGTAGG + Intergenic
1086905428 11:92412983-92413005 CTTGGTATTGGACATTCTGTGGG + Intronic
1087988013 11:104709060-104709082 CTGGCTATGGGCCTTTTTGTGGG - Intergenic
1088112424 11:106277703-106277725 TTGGGTGTGCCCCCTTCTGTAGG - Intergenic
1088949665 11:114554862-114554884 CTGTGCATGGGCCCATTTGTGGG + Intronic
1089472753 11:118734045-118734067 CTGGGTATGGTTGCTTCTGCCGG + Intergenic
1102527304 12:113521011-113521033 CTGGGTCTTGACCCTTCTGATGG + Intergenic
1103458466 12:121085717-121085739 CAGGGTTTGGGCCCTTCTCTTGG - Intergenic
1107617173 13:42181707-42181729 GTGGCTGTGGGCCCTGCTGTGGG - Intronic
1109792479 13:67267747-67267769 CACTGTATGGACCCTTCTGTAGG + Intergenic
1110118012 13:71844074-71844096 CAGGTGAGGGGCCCTTCTGTGGG - Intronic
1113525004 13:110967815-110967837 CTGGGTTTGGAGCCATCTGTTGG - Intergenic
1118769150 14:68929931-68929953 CTGGGCTGGGGCCCCTCTGTTGG - Intronic
1119654146 14:76404928-76404950 CTGGGTCTGTCCCCTTCTGAGGG - Intronic
1120942186 14:89958970-89958992 CAGGGTTTGGGCTCTTCTGCAGG - Intronic
1121448759 14:93994826-93994848 CTGGTTATGGGACCTTCACTGGG - Intergenic
1123981050 15:25603579-25603601 CTGGTTCTGGGCCTTTCTTTAGG + Intergenic
1126441843 15:48697846-48697868 CTGGGTATGAACCATACTGTGGG + Intergenic
1128182938 15:65621007-65621029 CAGTGGGTGGGCCCTTCTGTGGG + Intronic
1129523166 15:76198431-76198453 CTGGGAATGGGCCACACTGTTGG - Intronic
1130322104 15:82850124-82850146 CTGGGTGTTGGTCCCTCTGTGGG - Intronic
1130404351 15:83584629-83584651 CTGAGTGTGAGCCCATCTGTAGG + Intronic
1130799043 15:87242426-87242448 CTGGGTCTCCTCCCTTCTGTGGG + Intergenic
1132765201 16:1530990-1531012 CTGGGTCTGGACGCTTCTGGCGG - Intronic
1133735767 16:8614482-8614504 CTTGGTATTGTACCTTCTGTAGG - Intergenic
1136334947 16:29605190-29605212 CTGGGGGGGGGCCCTCCTGTTGG + Intergenic
1138697269 16:58826285-58826307 CTGGGGATGGCCTCATCTGTGGG + Intergenic
1141554375 16:84827234-84827256 CGGAGTCTGGCCCCTTCTGTTGG + Intronic
1142607741 17:1091369-1091391 GTGTGGATGGGCACTTCTGTGGG - Intronic
1144211688 17:13021174-13021196 CTGGGTACTGGCCCTGCTGGGGG + Intergenic
1144369068 17:14572803-14572825 ATGGGTATGGGTCCTTCTTTTGG - Intergenic
1146942456 17:36853223-36853245 CTGTGTCTGTGCCCTTCTTTAGG + Intergenic
1147762415 17:42807952-42807974 CTGGGTCTTGGCACTTCTGTAGG - Intronic
1150196464 17:63304632-63304654 CTGGGTAGGGGGCCTTGTCTGGG + Intronic
1150223320 17:63509271-63509293 CTGGGTAAAGGCCCTGCTGGTGG + Intronic
1152275262 17:79352850-79352872 CTGGGAATGGGTCCTCCTGCTGG + Intronic
1152608543 17:81304758-81304780 CTGGGTTTGGTCCCTTCCTTGGG + Intergenic
1153634864 18:7104861-7104883 CTGGGCCTGGGCCCGTCTGCAGG - Intronic
1157288668 18:46394462-46394484 CTGGGGATGTGCAGTTCTGTGGG + Intronic
1160459900 18:79031071-79031093 CTGTGTCTGGGACCTTCTGAAGG + Intergenic
1161059247 19:2206893-2206915 CTGGGGCTGGATCCTTCTGTGGG + Intronic
1162268364 19:9594522-9594544 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
1164896722 19:31883331-31883353 CTGGGTCCGGGACCTGCTGTAGG - Intergenic
1165921087 19:39298225-39298247 CGGGGCCTGGGCCCTGCTGTGGG - Exonic
925382186 2:3436622-3436644 CTTGGTGTTGTCCCTTCTGTGGG + Intronic
926250818 2:11154929-11154951 CGGGGGATGGGCCATTCTGCCGG - Intergenic
928935815 2:36676976-36676998 CTGTGTATGGACACTCCTGTAGG + Intergenic
933605121 2:84374671-84374693 CTGGGTTTGGTTCCTTCTGAGGG - Intergenic
933691303 2:85181422-85181444 CTGGGCATGGGCCCGCCTGCTGG + Intronic
934990148 2:98914910-98914932 CTGGGGCTGGGCCCTGCTCTGGG - Intronic
935048034 2:99499229-99499251 CTGGGTTTGGAGCCATCTGTTGG - Intergenic
937940810 2:127284442-127284464 CAGGGTGTGGGCCCTGCTGTGGG - Intronic
944687961 2:202134485-202134507 CTTGGTATGGGACCCTCTTTTGG - Intronic
945037258 2:205714957-205714979 CTGGGAATGCACCCTTCTGTGGG - Intronic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948596833 2:239084861-239084883 GTGGGTATGGGCGTATCTGTGGG - Intronic
949045749 2:241872014-241872036 CGGGGTCTGGGGCCTTCTGGAGG - Exonic
1168823672 20:794252-794274 CTGGGTTTGGAGCCATCTGTTGG - Intergenic
1170593169 20:17786633-17786655 CTGGGTCTCTGCCTTTCTGTTGG - Intergenic
1172096366 20:32462437-32462459 GTGGGCATGAGCCCTCCTGTGGG - Intronic
1172449025 20:35008799-35008821 CTGGGGATGGGTCATTCTGCTGG + Intronic
1172914611 20:38434456-38434478 TTGGGGAAGGACCCTTCTGTGGG - Intergenic
1173720589 20:45254373-45254395 GTGGGTGTGTCCCCTTCTGTAGG - Intronic
1176063984 20:63184767-63184789 CTGGAAATGGGCTTTTCTGTGGG - Intergenic
1177904695 21:26961378-26961400 CTGCCTATGGACCTTTCTGTAGG - Intronic
1179021023 21:37641165-37641187 CTGGGGATGGGGGTTTCTGTGGG + Intronic
1180963499 22:19773571-19773593 CTGGGCATGGGCTCTCCTGAAGG - Intronic
1181184946 22:21096544-21096566 CATAGAATGGGCCCTTCTGTTGG + Intergenic
1182824161 22:33248605-33248627 CTTGGTGTGGTCCATTCTGTGGG + Intronic
1184679565 22:46062975-46062997 CTGGGTAGGGGTCCTGCCGTGGG + Intronic
1185326264 22:50227291-50227313 CTGGGTGTGGGTACTTCAGTGGG - Intronic
1185371874 22:50464723-50464745 CTGGGTACGGGTTCTCCTGTGGG + Exonic
950086473 3:10261857-10261879 CTGGGTGTGGGTGCTTCTGAAGG - Intronic
950846640 3:16021814-16021836 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
952193395 3:31047250-31047272 CTGGCAATGGCCCCTTCTGCTGG + Intergenic
954431122 3:50471359-50471381 CTGGTGAGGGGACCTTCTGTGGG + Intronic
957256030 3:77838995-77839017 GTGGGTATGGGCACAACTGTTGG - Intergenic
960673463 3:120173378-120173400 CTGGGTATGGAAGCTTTTGTTGG + Exonic
961582354 3:127893109-127893131 CTGGGTTTGGAGCCATCTGTTGG - Intergenic
965691897 3:171366137-171366159 ATGGGTATGTGGCCTTTTGTTGG + Intronic
969966391 4:11001104-11001126 CTGGCCCTGGGCCCTGCTGTAGG - Intergenic
970448365 4:16142680-16142702 CTGGGTGTGAACCCTGCTGTGGG - Intergenic
975975383 4:80089674-80089696 CTGGGTAAGGCCCAATCTGTAGG + Intronic
980868198 4:138578463-138578485 CTGGGTATGGTATTTTCTGTTGG - Intergenic
984962030 4:185107046-185107068 CTGGGCATGGGGCATCCTGTTGG - Intergenic
989615554 5:43334100-43334122 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
991971767 5:72148349-72148371 CTGGGTATGGGCCCTTCTGTGGG - Intronic
992610213 5:78501410-78501432 CTGGCTGAGGGCCCTTCTGCGGG + Intronic
993511729 5:88778997-88779019 ATGGGTATTGGCCCGGCTGTGGG - Intronic
995829925 5:116344305-116344327 CTGACAATGGGCCCTTCTGCTGG - Intronic
996352793 5:122564033-122564055 CTGGGTCTGGTCCCTCCTGTGGG - Intergenic
997568459 5:134906989-134907011 CTGGGTGTGGTCCCTGCTGCTGG + Intronic
998143632 5:139713262-139713284 CTGGGTGTGGTCTCATCTGTGGG + Intergenic
998953211 5:147412737-147412759 CTGGTAATTGGCCCTTCTGTGGG - Intronic
1001491643 5:172160175-172160197 CTGGCTAGGGGCCATTTTGTAGG - Intronic
1001574515 5:172753894-172753916 CTTGGTATTGGACATTCTGTGGG - Intergenic
1002106161 5:176880309-176880331 CTGGGTAGGGGCACGTCTGAGGG + Exonic
1004553229 6:16670041-16670063 CTGGGTCTGGTCACTTCTGTGGG + Intronic
1015186147 6:130418700-130418722 CTGGGTTTGGGTCCTTCCTTTGG + Intronic
1017989526 6:159473868-159473890 CTGGGTAAGGTCTCTTCTTTGGG - Intergenic
1018039279 6:159907405-159907427 ATTGGTCTGTGCCCTTCTGTGGG + Exonic
1019289077 7:241174-241196 CTGGGTCTGGCCCCTTCCCTGGG + Intronic
1022572283 7:31466973-31466995 ATGGGGTGGGGCCCTTCTGTAGG + Intergenic
1022709576 7:32838138-32838160 ATGGGGTGGGGCCCTTCTGTAGG - Intergenic
1023314344 7:38920062-38920084 CTGGGTATGCTCCCTTCTTAGGG - Intronic
1024043529 7:45573212-45573234 CTGGGAGTGGGGCCTTCTGCAGG + Intergenic
1026941490 7:74290047-74290069 CGGGGGTTTGGCCCTTCTGTTGG + Intronic
1029471189 7:100755292-100755314 CTAGCTGTGGGCCCCTCTGTCGG + Exonic
1030065171 7:105653822-105653844 CTGGCTCTGTGCCTTTCTGTGGG + Intronic
1033098031 7:138447844-138447866 CTGGGTTTGGAGCCATCTGTTGG + Intergenic
1034242423 7:149620794-149620816 CAGGGTATGGACCTTTCTATTGG - Intergenic
1034527556 7:151675397-151675419 GTAAGTCTGGGCCCTTCTGTGGG - Intronic
1034881814 7:154768269-154768291 CTGGGACTGTGCCCTCCTGTGGG + Intronic
1038493405 8:27985636-27985658 CTGGGTATGTGACCCTCTGTGGG - Intronic
1042096048 8:65217153-65217175 CTTGGTGAGGGCCCTCCTGTAGG - Intergenic
1043931666 8:86098649-86098671 CTGGGAAGGGTCCCATCTGTGGG + Intronic
1045935508 8:107674259-107674281 CTGGGTGTGAGCCCCTCTTTTGG + Intergenic
1048967253 8:139624051-139624073 CTGGCTTAGGGCCCTGCTGTTGG - Intronic
1049154893 8:141060389-141060411 CTGGGTCAGGGCCCCTTTGTAGG - Intergenic
1049309025 8:141923610-141923632 CTGGGCATGGGCCCTGCTTGTGG - Intergenic
1051579530 9:18656055-18656077 CAGGGTATGAGACATTCTGTAGG + Intronic
1053667191 9:40324595-40324617 CTGGGTATGGTCACTCCTGCTGG + Intronic
1053916770 9:42949700-42949722 CTGGGTATGGTCACTCCTGCTGG + Intergenic
1054378335 9:64464623-64464645 CTGGGTATGGTCACTCCTGCTGG + Intergenic
1054517419 9:66051688-66051710 CTGGGTATGGTCACTCCTGCTGG - Intergenic
1055447619 9:76398634-76398656 CGCCGTATGGGCCCCTCTGTAGG - Intergenic
1059234180 9:112748384-112748406 CTGGGTCTGGGTCCTTTTTTTGG + Intergenic
1061546330 9:131306798-131306820 GTGGGTATGGGGCATTCTTTTGG + Intronic
1062630409 9:137460771-137460793 CTGGGTACGGTCCCTTCCTTGGG - Intronic
1185479416 X:435051-435073 CAGGGAAAGGGCCCTTCTGAGGG - Intergenic
1186001533 X:5017467-5017489 CTGGGTAGGGGTCTTGCTGTTGG - Intergenic
1186624382 X:11277001-11277023 CTGGGTATGGGCTTTCCTTTTGG - Intronic
1188340605 X:28996434-28996456 CTTTGTATGGGCACTTCTTTTGG + Intronic
1189312930 X:40032761-40032783 CTGGGTTTTGGCTCTTCTGGGGG + Intergenic
1189834201 X:45004325-45004347 CTGGGTTTGGAGCCATCTGTTGG + Intronic
1192940208 X:75903897-75903919 CTCGATATGGGCACTTATGTGGG - Intergenic
1196727774 X:118912746-118912768 CTGGGCAGGGGCAGTTCTGTAGG - Intergenic
1196993181 X:121350299-121350321 CTGAGTATGAGCACTTTTGTAGG - Intergenic
1199584677 X:149401888-149401910 CTGGGCCTGGGCCTTTGTGTGGG + Intergenic