ID: 991973068

View in Genome Browser
Species Human (GRCh38)
Location 5:72159488-72159510
Sequence GTGGACTAGCAAGTAAACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991973068 Original CRISPR GTGGACTAGCAAGTAAACAC TGG Intronic
906419097 1:45648413-45648435 ATGGAATAACAAGTAAATACAGG - Intronic
918106337 1:181418434-181418456 GAGCACTAGGAAGTAAGCACTGG - Intronic
924838264 1:247677646-247677668 GTGCACTGCCAAATAAACACTGG + Intergenic
1063673950 10:8122909-8122931 GTAGACTAGCAATGAACCACAGG - Intergenic
1077223470 11:1427435-1427457 GCAGACTAGCACGTTAACACGGG - Intronic
1080888485 11:36388175-36388197 ATGGGCTAGCAAATAAACACTGG - Intronic
1081246646 11:40775108-40775130 GTGGACAAGAAAGTAAATATTGG + Intronic
1087463593 11:98475983-98476005 GTTTTCTACCAAGTAAACACAGG + Intergenic
1088059138 11:105624371-105624393 GTGAACTAGCAAGCACACTCAGG + Intronic
1092801102 12:12167730-12167752 GTGCACTATCTGGTAAACACTGG + Intronic
1095666294 12:44803115-44803137 GATGAGTAACAAGTAAACACTGG + Intronic
1096579939 12:52578467-52578489 TTGGACTAGCATGGAAAAACAGG - Intergenic
1100481549 12:94984219-94984241 GTGGACAAGCTAGGAAACATGGG - Intronic
1109418950 13:62084592-62084614 GTTCACTAGCAAATAAACAAAGG + Intergenic
1110235095 13:73209516-73209538 GTGCACTAAAAAGGAAACACAGG - Intergenic
1116983555 14:51195924-51195946 GTAGACTAGCAGGTACACAAAGG + Intergenic
1121827422 14:97021867-97021889 GTGGACTAGCACGTAGACATGGG - Intergenic
1123143258 14:106104277-106104299 GGGGAAAAGCAAATAAACACGGG - Intergenic
1124036608 15:26058772-26058794 TTGGAATAGCAAATGAACACTGG - Intergenic
1125126148 15:36223381-36223403 GTGGACCAGCAAATGAACTCAGG + Intergenic
1128606377 15:69039396-69039418 GTGGAGTAGCAAGGAAAGAAGGG + Intronic
1131928208 15:97409935-97409957 GTGGAACAGCACCTAAACACTGG - Intergenic
1142500541 17:330399-330421 ATGGACAAGCAAGGAAAGACAGG + Intronic
1143320299 17:6064232-6064254 GTGCACCAGCCAGTAGACACAGG - Intronic
1145962785 17:28897279-28897301 GAGGAGAAGCAAATAAACACAGG + Intronic
1147952059 17:44112804-44112826 GTGGACCAGCAAAGAAACAGGGG + Intronic
1150753880 17:67892852-67892874 GTGGACTATCAGATAAACAGTGG - Intronic
1155812386 18:30253548-30253570 TTGGCCTAGTAAGTAAACAATGG - Intergenic
1158247300 18:55446395-55446417 GTGGAATAGCAGCTAAACATGGG - Intronic
1159968661 18:74621902-74621924 GAGGACTAGCACATAAACACTGG - Intronic
926315246 2:11704883-11704905 GGGGACTAGCTAGTCATCACTGG + Intronic
926379813 2:12275729-12275751 GTGGATTAGAAAGTCAACTCTGG + Intergenic
932986587 2:76733331-76733353 GTGGCATAGCAAGTAAGCAGTGG - Intergenic
947421169 2:229942642-229942664 GTGGAGCAGCAAGTAGGCACTGG - Intronic
948219398 2:236257722-236257744 GTTGACCAGCAAGTGAACACAGG + Intronic
1172922108 20:38492635-38492657 GTGAACTAAAAAGTAAATACAGG - Intronic
1173729335 20:45317656-45317678 GTGGACCAGGGAGCAAACACAGG - Exonic
1174346934 20:49936893-49936915 GTGGACTAGAAAGGAAACGTCGG - Intronic
1179442229 21:41403352-41403374 GGTGACTAGCAAGTGAACTCTGG - Intronic
955735099 3:62030588-62030610 GTTGACCAGCAAGTGAGCACTGG + Intronic
956094514 3:65702126-65702148 GTGGGCTCGCTCGTAAACACAGG - Intronic
956571115 3:70696345-70696367 GTGGAGTTGCAAGAAAAAACAGG - Intergenic
960294359 3:115925073-115925095 GTGGACTTGGAAGGAAACCCAGG - Intronic
962863520 3:139426468-139426490 GTGAAGTAGCCAGAAAACACTGG - Intergenic
965012775 3:163116541-163116563 GTGGACTGCCTTGTAAACACTGG - Intergenic
966563941 3:181355214-181355236 GGAGACTAGGAAATAAACACAGG - Intergenic
968900499 4:3429361-3429383 GTGGACTGGCAAGTACGCCCTGG - Intronic
972560935 4:40228472-40228494 TTGGACCAGCAAGTAAAAGCAGG + Intronic
974148361 4:57973843-57973865 GTGGAAGACCAAGTAAAAACTGG - Intergenic
982186689 4:152809071-152809093 GTGTTGTAGCATGTAAACACAGG + Intronic
982531093 4:156544987-156545009 GGGGATTAGGAAGGAAACACAGG - Intergenic
985424192 4:189812549-189812571 GGGGAATAGCAAGTGATCACTGG - Intergenic
987237611 5:15958700-15958722 GTGGACGTGCAATTCAACACAGG - Intergenic
991973068 5:72159488-72159510 GTGGACTAGCAAGTAAACACTGG + Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
995491837 5:112701650-112701672 GAGGAGAAGGAAGTAAACACTGG + Intergenic
996916294 5:128715624-128715646 GAGGACCAGCAAGTAAATACTGG - Intronic
999884735 5:155909422-155909444 GTGGAATAGCAAGTGAATAAAGG - Intronic
1002985127 6:2182541-2182563 TTGGAATTGCAAATAAACACTGG - Intronic
1004113349 6:12743136-12743158 GTGAACTAACAAGTAATCTCTGG - Intronic
1019156125 6:170039937-170039959 GTGGACCAGCAAGAACACATAGG - Intergenic
1019874745 7:3799780-3799802 TTGGAGGAGCAAGTAAACTCAGG - Intronic
1023676217 7:42632922-42632944 GTAGAATAGCAAGAAAACATTGG + Intergenic
1025566737 7:62444549-62444571 ATGGACTAGAAAGTAATCATTGG - Intergenic
1027526467 7:79275751-79275773 GTAGAATAGTAAGTGAACACTGG - Intronic
1031960836 7:127988408-127988430 GTGGACTAGCAACGTAACAAAGG + Intronic
1037678147 8:21069974-21069996 GTGGACTAGCCAGCTAACACTGG + Intergenic
1040649973 8:49436470-49436492 GTGGACTAGTAAGTAGACATTGG + Intergenic
1042525122 8:69756739-69756761 GAGCACTAGGAAGCAAACACAGG + Intronic
1047173713 8:122520401-122520423 CATGACTAGCAAGTAAGCACAGG - Intergenic
1050466825 9:5935514-5935536 GTGGACTAGAAATTAACCACTGG + Intronic
1053152282 9:35750668-35750690 GTGGAGTAGAAAGGATACACTGG - Exonic
1056496125 9:87157125-87157147 GGGGACTAGCAAGTACCCTCTGG + Exonic
1058392642 9:104513302-104513324 TTGGACTAGTAAGTAAACTGTGG + Intergenic
1058599718 9:106656216-106656238 GTGGTCTGGCAGGAAAACACTGG - Intergenic
1060084716 9:120686710-120686732 GTGGACTAGAATCCAAACACTGG + Intronic
1060167651 9:121432240-121432262 GTGTCCTAGCAAATAACCACAGG - Intergenic
1190621309 X:52289105-52289127 GTGCATGAGCAAGTGAACACAGG - Intergenic
1193553930 X:82931163-82931185 TTGGCCTAGCAAGAAACCACTGG - Intergenic
1194123606 X:89988813-89988835 TTGGACTAGCAAGAAATCATTGG + Intergenic
1196313840 X:114199439-114199461 GTCAACTAGCAAGTAATGACTGG - Intergenic
1198090280 X:133322103-133322125 GTGGACTGGCCAGGATACACGGG - Intronic
1200476491 Y:3646434-3646456 TTGGACTAGCAAGAAATCATTGG + Intergenic