ID: 991975510

View in Genome Browser
Species Human (GRCh38)
Location 5:72180210-72180232
Sequence CTTGCTCAAGTCTACTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 90}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991975507_991975510 9 Left 991975507 5:72180178-72180200 CCATCACTTGTGGAGGGAGCCAC 0: 1
1: 0
2: 1
3: 11
4: 117
Right 991975510 5:72180210-72180232 CTTGCTCAAGTCTACTTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 90
991975508_991975510 -10 Left 991975508 5:72180197-72180219 CCACTTTATGTACCTTGCTCAAG 0: 1
1: 0
2: 1
3: 8
4: 121
Right 991975510 5:72180210-72180232 CTTGCTCAAGTCTACTTGTATGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991975510 Original CRISPR CTTGCTCAAGTCTACTTGTA TGG Intronic
907791102 1:57664580-57664602 TTTGCTTAAGCCTACTTTTAGGG + Intronic
910813721 1:91265558-91265580 GTTGCTGAAGTCTTATTGTAAGG - Intronic
917655877 1:177124887-177124909 CTATCTCAAGTCTGCTTGTGTGG + Intronic
918744054 1:188176257-188176279 CATGTTCCAGTCTACTTGTTAGG + Intergenic
923009000 1:230073509-230073531 CTTAGTCATGTCTACTAGTATGG + Intronic
1068827536 10:61455847-61455869 CTTTCTCAAGCCTACTAGGAAGG + Intergenic
1072742698 10:97919379-97919401 CTTTCTCATCTCTACTTGGAAGG - Intronic
1073620453 10:105041937-105041959 CTGGCTCAAGTCTCCTTCCATGG - Intronic
1073778749 10:106814377-106814399 CTTGCTCCAGTTTTCTTGTCTGG - Intronic
1074267442 10:111918546-111918568 CTTGCTCCAGTCTACCTTTATGG - Intergenic
1075210358 10:120485793-120485815 CTTGCCCATCTCTCCTTGTAAGG + Intronic
1085194563 11:74660960-74660982 CTTGGTCAATTCTACTATTAAGG + Intronic
1086033258 11:82385131-82385153 CTTGATCAAGTCTGCTATTAAGG - Intergenic
1088009936 11:104987387-104987409 CTTGATCAATTCTACTATTAAGG - Intergenic
1091115519 11:133009058-133009080 ATTACTTAAGTCTACATGTATGG + Intronic
1091656788 12:2351867-2351889 CTTGCTCCCGTCTCCTTGTTGGG - Intronic
1091946901 12:4554299-4554321 CCTGCTCACGTTTACTTATAAGG + Intronic
1093095843 12:14971317-14971339 CTTTCTCAAGTGTACTGGGATGG + Intergenic
1093439891 12:19182147-19182169 CTTGCTCAAGACTAATTTTCTGG - Intronic
1098433587 12:70446589-70446611 CTTGCCCAAGCATCCTTGTAGGG + Intergenic
1100315042 12:93437468-93437490 GTTGCTCTGGTCTTCTTGTAAGG + Intronic
1103297149 12:119897371-119897393 TTTGCTCAAGTCTAGTTGCATGG - Intergenic
1107168002 13:37305591-37305613 CTTGGCCAAATCTACTTGTAAGG + Intergenic
1107692951 13:42970141-42970163 CTTGCTCAAGTCCAGCTGTGGGG - Intronic
1108967862 13:56334143-56334165 CTTGCTTGAGTCTATTTGTTTGG - Intergenic
1110510896 13:76348940-76348962 CTTTCTCAAGTATACTTAAAAGG - Intergenic
1112669604 13:101619350-101619372 CTTTCCCATGTCCACTTGTAAGG - Intronic
1117213201 14:53522987-53523009 TTTTCTCAAGTCTATATGTAAGG - Intergenic
1119988267 14:79165200-79165222 CTTGCCCAGGTCCACTTCTAAGG + Intronic
1120349096 14:83329878-83329900 TTTTCTCCAGTATACTTGTACGG + Intergenic
1129180470 15:73871288-73871310 TTGGCTCAAGGCCACTTGTATGG + Intergenic
1134801452 16:17088533-17088555 CTTGCTCCAAGCTACTTTTATGG + Intergenic
1139331675 16:66197062-66197084 CTTTGTCAAATCAACTTGTAAGG + Intergenic
1143306947 17:5954889-5954911 CTTTCTCAAGTCTCCTTGCGTGG + Intronic
1153126265 18:1795660-1795682 CTTGCTTAAGTCCTCTTATAAGG + Intergenic
1158619886 18:59023727-59023749 CTTGCTGAAGTTTAATTGTGAGG + Intergenic
1166168896 19:41012964-41012986 CTTTCTCAAGCCTCCTTATAGGG - Intronic
928744988 2:34401884-34401906 CTTGTTCAATTCTTCTTGTTTGG - Intergenic
932185127 2:69688064-69688086 CTTGCTCAAGTCAGGATGTAGGG + Intronic
933065304 2:77785503-77785525 CTTTCTCAATTCTTCTTGTTAGG + Intergenic
939672832 2:145034705-145034727 CTTGATCAAGTCCAGATGTAGGG - Intergenic
939698367 2:145357166-145357188 CTCTCTCAAGCCTACTTGTATGG - Intergenic
939879278 2:147611755-147611777 CTTGCACAAATCCACCTGTAGGG + Intergenic
941570960 2:167169913-167169935 CTTGCCCTATTATACTTGTAAGG + Intronic
942470721 2:176256987-176257009 TTTGCACAAGTCTACTTTTCTGG - Intergenic
943182704 2:184563158-184563180 TATGCTCAAGTCCACTTCTAAGG - Intergenic
944438750 2:199720304-199720326 CTTGCTCAATTTTTATTGTAGGG - Intergenic
1173129799 20:40380783-40380805 TTTGCTAATGTCTACTTATATGG + Intergenic
1177854039 21:26382146-26382168 CTTGCACAAGCCTACTGCTAAGG - Intergenic
1180625541 22:17191237-17191259 CTGGCTCAAGTCTGCGTGTGGGG - Intronic
1181848917 22:25735840-25735862 CTGGCTCAAGGTTACTTGGAGGG - Intergenic
1182031816 22:27165037-27165059 ATTGCTCAAGTCCCCTTGGAGGG - Intergenic
949333906 3:2952356-2952378 CTTGCTCAAGACTACATAGATGG - Intronic
950470727 3:13184589-13184611 CTTGCTCTAGTACACTTGTTAGG - Intergenic
954992875 3:54855983-54856005 ATTCCTCAAGTCTTCTTGCATGG + Intronic
955595897 3:60590175-60590197 CTTGCTCAAGTCTGCAAGAAGGG + Intronic
955680357 3:61494158-61494180 CTTGTCCAAGCCAACTTGTAAGG - Intergenic
956944568 3:74205528-74205550 TTTTCTCAAGTCTTCTTTTATGG - Intergenic
959095265 3:101948953-101948975 CTTGCCCAAGACTATTGGTATGG + Intergenic
967381906 3:188868415-188868437 GTTGCTCAAGTCTGCTTTTTGGG - Intronic
969657310 4:8505685-8505707 CTTGCTCAAGGCCACTGATATGG + Intergenic
969716316 4:8869976-8869998 CCTGCTCAAGTCTACGTGAAGGG + Intronic
972669618 4:41202289-41202311 ATTGTACAATTCTACTTGTATGG - Intronic
973148790 4:46861971-46861993 CTTGCTCAAGTCCATCTGTCTGG + Intronic
973740832 4:53917875-53917897 CTTGCTCACCTATACTTGTTTGG - Intronic
981774423 4:148348718-148348740 AGTGCTTATGTCTACTTGTAAGG + Intronic
991538423 5:67699397-67699419 CTTGGTGAAGTCTACTGGAAGGG - Intergenic
991975510 5:72180210-72180232 CTTGCTCAAGTCTACTTGTATGG + Intronic
993174710 5:84469010-84469032 CTTGCTCAAGTTCATTTGTTTGG + Intergenic
999056978 5:148588333-148588355 ATTGCTCAGGTCTGATTGTACGG - Intronic
1000028839 5:157384295-157384317 CTTGCTGAAATCAACTTGAAAGG - Intronic
1000551350 5:162669004-162669026 CTTCCTCAAGTATATTTTTAAGG - Intergenic
1002108697 5:176893504-176893526 CTTGCTCAAGGCTACATCTGAGG + Intronic
1003775873 6:9363289-9363311 CATGCTCAAGTTTATTTGAATGG + Intergenic
1010291294 6:74141065-74141087 CTTGCTCTCTTCTTCTTGTAAGG - Intergenic
1012467747 6:99534280-99534302 CTGGTTCAACTCTACTTCTAGGG - Intergenic
1012799818 6:103811389-103811411 CTTGGTCATATCTACTTGCAAGG - Intergenic
1013661551 6:112302482-112302504 CTAGCACAAGTCTTCTTGCACGG - Intergenic
1015606763 6:134964725-134964747 CTTTCACAAGTTTACTTGTTTGG + Exonic
1018053693 6:160033545-160033567 CTTGCCGAAGTCTACTAGGAAGG - Intronic
1024956681 7:54927944-54927966 CTTGATCAATTCTGCTAGTAAGG - Intergenic
1025119963 7:56293335-56293357 CTTGCTTAAGGCTGCTTATATGG + Intergenic
1029815462 7:103090073-103090095 CTTCCCCAACTCTACCTGTAGGG - Intronic
1032388962 7:131543532-131543554 CTTGCTCGTCTCTACTTGTTGGG - Intronic
1034206412 7:149319582-149319604 CTTCCCCAACTCTATTTGTAAGG - Intergenic
1039222476 8:35349136-35349158 CTTTGTCAAGTATACTTGTGGGG - Intronic
1042213637 8:66406523-66406545 CTTGCTCATGTCAGCTGGTAGGG - Intergenic
1043197903 8:77323255-77323277 CTTTCTGAAGTTTACTTGTCTGG - Intergenic
1043359057 8:79449306-79449328 CATACTCAAGTCCCCTTGTAAGG + Intergenic
1044734424 8:95265023-95265045 CTAAATCTAGTCTACTTGTAAGG - Intronic
1056083380 9:83120517-83120539 CTTGCTCATGTCCATTTGGATGG - Intergenic
1059192159 9:112336321-112336343 GTTTCTCAATTCTACTTCTAGGG - Intergenic
1191134951 X:57053850-57053872 ATTGCTCATGTTTTCTTGTAGGG + Intergenic
1192595072 X:72397950-72397972 GTTTCTCAAGTCTATTTATAGGG + Intronic
1193204701 X:78735131-78735153 CTTGATCAATTCTGCTAGTAAGG + Intergenic
1196613925 X:117745116-117745138 CTTGCTCAATTCTGCTATTAAGG - Intergenic