ID: 991977155

View in Genome Browser
Species Human (GRCh38)
Location 5:72194738-72194760
Sequence CTGAAGTTAAGTAGGAAATC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991977155_991977158 -3 Left 991977155 5:72194738-72194760 CCCGATTTCCTACTTAACTTCAG 0: 1
1: 0
2: 2
3: 13
4: 180
Right 991977158 5:72194758-72194780 CAGTCTCATCTTTGATTGTGTGG 0: 1
1: 0
2: 0
3: 11
4: 151
991977155_991977159 16 Left 991977155 5:72194738-72194760 CCCGATTTCCTACTTAACTTCAG 0: 1
1: 0
2: 2
3: 13
4: 180
Right 991977159 5:72194777-72194799 GTGGCATCCAGCAAACCCTGCGG 0: 1
1: 1
2: 2
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991977155 Original CRISPR CTGAAGTTAAGTAGGAAATC GGG (reversed) Exonic
901939871 1:12653777-12653799 CTGAAGTAAAGTAAAATATCCGG - Intronic
906043036 1:42804270-42804292 CAGGTGTTAAGTGGGAAATCAGG + Intergenic
908726561 1:67183078-67183100 CTGATCATAAGTAGGAAATAAGG - Intronic
909411170 1:75353735-75353757 CAGAAAGTAAGTTGGAAATCCGG - Intronic
909440021 1:75686696-75686718 CTCTAGTGAAGTAGGAAATCAGG + Intergenic
910399586 1:86825405-86825427 CTGTAGTTATGGAGGAATTCAGG + Intergenic
911093572 1:94037415-94037437 GTGGAGAGAAGTAGGAAATCTGG - Intronic
911762780 1:101635694-101635716 CTGAAGCTCAGCAGGAAGTCTGG - Intergenic
911800160 1:102126316-102126338 CTGAAGGGAAGGAGGAAATGTGG + Intergenic
912040581 1:105384371-105384393 CTTAATTTAAGAAGGAAAACCGG - Intergenic
915040607 1:152965373-152965395 CTGAATTTCACTGGGAAATCTGG + Intergenic
916053017 1:161049206-161049228 CTGAAGTTGAGGAGGAAAATGGG - Exonic
917343685 1:174006674-174006696 CTGGTTTTAAGTAGGAACTCTGG + Intronic
918845312 1:189602104-189602126 TTCAAGTTAAGGAGAAAATCAGG - Intergenic
919016697 1:192047614-192047636 CTGAAATTCAGTAGAAAATTTGG - Intergenic
919879294 1:201891563-201891585 CTGCAGGTAAGTAAGCAATCTGG + Exonic
921199577 1:212792134-212792156 CTGAGGTTAAATAGGGAATAGGG - Intronic
921498786 1:215874789-215874811 GTTAAGTTAAGAAGGAAATTGGG + Intronic
921988189 1:221335129-221335151 CTGAACCCAAGTAGGAAAGCAGG + Intergenic
922882183 1:228989435-228989457 AAGAAGTTAGGTAGGAAGTCAGG + Intergenic
923006362 1:230053249-230053271 CTGAAGTAAAGGAGGAAAAGAGG + Intergenic
924874913 1:248092143-248092165 CTGAAGTTATTTATCAAATCAGG + Intronic
1063731676 10:8704444-8704466 CTAATGTTAAGTAGGAAATCAGG - Intergenic
1065370494 10:24980187-24980209 CTGAAGATGAGGAGGAAATCAGG - Intergenic
1065524113 10:26601133-26601155 CCAATGTAAAGTAGGAAATCAGG - Intergenic
1065837778 10:29674915-29674937 CGGAAGTGAAGAAGGAAGTCAGG - Intronic
1067683097 10:48452311-48452333 CTGAAGTTGACTAGGAATCCTGG + Intronic
1069688443 10:70334347-70334369 CTGAAGTGAAGTAGGAAGCTGGG + Intronic
1069965328 10:72110486-72110508 CAGAAGTTAAAGAGCAAATCAGG + Intronic
1080379492 11:31753304-31753326 CTGAAGATAAGTAAGTAAACAGG - Intronic
1081256682 11:40905210-40905232 TTGAAATTAAGTAGGAAATGAGG - Intronic
1086302278 11:85439848-85439870 CTGGAGTTAAGCAGGAAGACTGG + Intronic
1090795816 11:130134881-130134903 CTGAGGTGGAGAAGGAAATCCGG + Intronic
1095478315 12:42608640-42608662 CTGCAGTTATGTGGGAGATCTGG + Intergenic
1095931796 12:47635233-47635255 CAAAAGTTAAGTAGGAAACATGG + Intergenic
1098070420 12:66668573-66668595 CTCTAGTTAAATAGGAAATTGGG + Intronic
1098742787 12:74195443-74195465 CTGAATTTGAATTGGAAATCAGG + Intergenic
1099942381 12:89203869-89203891 CTGAAGCTAGGTGAGAAATCAGG + Intergenic
1102818198 12:115886048-115886070 ATGAAGTTATGTTGTAAATCAGG + Intergenic
1105711735 13:23016414-23016436 CTGAAGTTATGTATAAGATCTGG + Intergenic
1106176260 13:27334849-27334871 ATGAAATAAAATAGGAAATCTGG - Intergenic
1106474819 13:30089552-30089574 TTGAAGAAAATTAGGAAATCAGG - Intergenic
1107541219 13:41390903-41390925 CTGAAGACCAGTAGGAAATGAGG - Intergenic
1109044506 13:57392024-57392046 CTGAAGTCACTTAGGTAATCTGG + Intergenic
1109848717 13:68032799-68032821 CTTTAGTCAAGAAGGAAATCTGG + Intergenic
1110978788 13:81870607-81870629 CTGATGTGAAGGAGAAAATCTGG - Intergenic
1111609250 13:90582164-90582186 CTGAAGTCAAGTAGAAAAATAGG - Intergenic
1113365124 13:109668884-109668906 CTGCAGTTTACTAAGAAATCAGG - Intergenic
1115258994 14:31433797-31433819 CTGAAGGTAGGGAGGAAATGGGG + Intronic
1116564040 14:46421981-46422003 CTGAGGTGAAGTGGGAAATAGGG + Intergenic
1117871984 14:60210744-60210766 ATGAAGCTAAGCAGGAAAGCTGG - Intergenic
1117886945 14:60374091-60374113 AGGAAGTTAAAGAGGAAATCGGG + Intergenic
1121199485 14:92105931-92105953 AGGAAGTGAAGTAGGAAACCCGG - Intronic
1124440140 15:29679696-29679718 CTGTCGTTCAGAAGGAAATCAGG + Intergenic
1130856284 15:87842433-87842455 CTGAAGTCAAGTTGGAACTAAGG - Intergenic
1132324638 15:100958624-100958646 TTGAAGTTAAGTTAGAAATTTGG - Intronic
1135931949 16:26745856-26745878 ATGAAGTTAAGTAAGAAAGTTGG + Intergenic
1138001233 16:53281988-53282010 TTGAAGGTAAGTATGGAATCTGG + Intronic
1138056259 16:53837115-53837137 CTGAAGTAAAATATGAAATCAGG - Intronic
1144182150 17:12762490-12762512 CTGGAGTTGAGGAGGAAGTCGGG + Intronic
1149287540 17:55181632-55181654 CTGAAGACAATTAGAAAATCCGG + Intergenic
1152337187 17:79705646-79705668 CTGAGTGTAAGGAGGAAATCAGG + Intergenic
1153461591 18:5339794-5339816 CTGTAGTAAAGTTTGAAATCAGG + Intergenic
1154305241 18:13225664-13225686 CTGAAGAGAATTAGGAAATAGGG + Intronic
1155040099 18:22057848-22057870 CAGAAATTAACTAGGAAATTTGG + Intergenic
1156760726 18:40585781-40585803 CTGAAGTGAAGGAGGGAGTCTGG + Intergenic
1159419298 18:68195795-68195817 CTGATGCTAAGTTGGAAATGGGG + Intergenic
1164153289 19:22572667-22572689 CTGAAGTGAAGGAGAAAAACTGG - Intergenic
925211962 2:2057094-2057116 CACAAGAGAAGTAGGAAATCTGG - Intronic
926350773 2:11992196-11992218 GTGAAGTTAAGCAGGACACCTGG - Intergenic
926872299 2:17435318-17435340 ATGAAGGTAAGCAGGATATCTGG + Intergenic
926940354 2:18129599-18129621 CTGAAGTTAAGTAAAAAGCCTGG + Intronic
927046509 2:19284363-19284385 CTGTAGTTTAGTTTGAAATCAGG - Intergenic
927381649 2:22486404-22486426 CTGAAGGGAAGTGGAAAATCAGG + Intergenic
927817959 2:26236929-26236951 CAGAAGTTATGAATGAAATCTGG - Exonic
933217695 2:79649352-79649374 CGGAAGTTCTGTAGGAAAGCTGG - Intronic
934092931 2:88569883-88569905 CTGAAGTACATGAGGAAATCTGG - Intronic
935613959 2:105056669-105056691 CTGAAGTAAAGTTGTAAAACTGG - Intronic
937862186 2:126719922-126719944 CTTGAGTGAAGTAGGAAGTCGGG + Intergenic
941455823 2:165711405-165711427 CTGAAGTGAAGGAGAAAAACTGG + Intergenic
943412617 2:187561768-187561790 CTGAAGTGAAGGAGAAAAACTGG + Intronic
945226376 2:207535192-207535214 CTGGAGTTAAACAGGAAATGAGG - Intronic
945791032 2:214305777-214305799 CTGAAGTATAGTTTGAAATCTGG + Intronic
947618801 2:231575736-231575758 CTGAATTTAAGTGAGGAATCTGG + Intergenic
1170173423 20:13440820-13440842 CTATAGTTGAGTAGGAAATATGG + Intronic
1170382187 20:15773270-15773292 CAGATGTTAAGTTGTAAATCAGG + Intronic
1171188755 20:23142955-23142977 ATGAAGGTAAGAAGGTAATCAGG + Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173026838 20:39315451-39315473 TTGAAGTTAAGAGGGAACTCAGG - Intergenic
1174024173 20:47558893-47558915 CTGAAGTTATGCACGACATCTGG + Intronic
1174101723 20:48131801-48131823 CTGGAGTTCATTAGGAATTCTGG - Intergenic
1174913064 20:54627471-54627493 CTTTAGTTAAGTAGAAAGTCAGG + Intronic
1175602176 20:60283704-60283726 CTAAAGTTAAAAAGGAAAACTGG + Intergenic
1177439803 21:21107543-21107565 CAAAAATTAAGTAGGAAATTTGG - Intronic
1178632954 21:34278407-34278429 CAGAAGTTGATAAGGAAATCTGG + Intergenic
1178734037 21:35132651-35132673 CTGAAGCTATTTATGAAATCTGG - Intronic
1181444018 22:22954784-22954806 CGGAAGCTAAGTAGGAAAGCGGG + Intergenic
1182149045 22:28015835-28015857 CTGAGGTTCAGTAGGTACTCTGG + Intronic
950321419 3:12058130-12058152 CTGTAGATAAGTAGGCCATCTGG + Intronic
951094340 3:18610442-18610464 CTCAAGTCACGTTGGAAATCTGG - Intergenic
951155235 3:19344568-19344590 CTGAAGCAAAGTATGGAATCAGG + Intronic
953158723 3:40398479-40398501 CTGAAGGCAAGAAGGAAACCAGG - Intronic
953627944 3:44586135-44586157 CTGAACTCAAGGAGGAGATCAGG + Exonic
954772273 3:52982331-52982353 GTGAAGTTATGCAGGACATCTGG - Intronic
955219520 3:57012081-57012103 CTGAGGTTGAGTATGAAATGGGG + Intronic
957341483 3:78903380-78903402 TTGAAGTTAAGTTGGAAGGCAGG - Intronic
958178420 3:90025702-90025724 CACAAGTTAAGTAGCAAATAGGG - Intergenic
958568991 3:95855399-95855421 CAGGAATTAATTAGGAAATCTGG - Intergenic
959552447 3:107678117-107678139 CTGAAGATAAGTGGGAAAAAAGG - Intronic
959635784 3:108567271-108567293 GTGATTTTAGGTAGGAAATCAGG + Intronic
962879147 3:139559661-139559683 ATGAAGTGAAGTAGGAAATCAGG - Intergenic
963033486 3:141003419-141003441 TTGAAGTTAAGTATAAAATCTGG + Intergenic
963565956 3:146931031-146931053 CTGTATTCATGTAGGAAATCAGG + Intergenic
963961906 3:151318854-151318876 ATGGTGTTAAGTAGGAAATAAGG + Intronic
964267550 3:154916179-154916201 CTGAAGTTAAGCACTAAATATGG - Intergenic
965201600 3:165665553-165665575 CTGAAGTTAAATAATAAATCTGG - Intergenic
970352087 4:15211922-15211944 CTGAAGTTATGTAGAAAACTAGG + Intergenic
972375782 4:38468894-38468916 CTGGGGCAAAGTAGGAAATCAGG - Intergenic
972734071 4:41823220-41823242 CTGAAGGTAAGGAGGAAAAAAGG + Intergenic
974854994 4:67450794-67450816 ATGAAGTTATTTAGGAAGTCAGG + Intergenic
974962255 4:68718641-68718663 CAGAAGTAAAGCAGGCAATCAGG - Intergenic
976978120 4:91188670-91188692 CTGATGTTGAGTAGGTATTCTGG + Intronic
982914348 4:161186854-161186876 ATGAAGTTAATTAGGAAAAGAGG + Intergenic
983256492 4:165406105-165406127 CGGAAGTTATGAATGAAATCTGG - Intronic
983641638 4:169948891-169948913 CTGAAATTAATGAGGAAATCTGG - Intergenic
984057478 4:174948216-174948238 CTGAAGGTAAGAAGACAATCTGG + Intronic
984402932 4:179290166-179290188 CTAAAGTTAGGTAACAAATCAGG - Intergenic
985119091 4:186621875-186621897 CTGAAATTAAGCAGAAACTCAGG + Intronic
988073257 5:26322441-26322463 GTGAAGGTAAGTTGGAAATGTGG - Intergenic
988340631 5:29966260-29966282 ATGAAATTAAGTCAGAAATCAGG + Intergenic
989346044 5:40430575-40430597 CTGGAGATAAGTAGGAACACTGG + Intergenic
990265585 5:54071545-54071567 CTGCATTCAAGTAGGAAACCTGG + Intronic
990918129 5:60933096-60933118 CTGAAATTAAATAGGAAATTTGG - Intronic
991478378 5:67048725-67048747 CTGAAGTTAAGTAGAAAACTGGG - Intronic
991977155 5:72194738-72194760 CTGAAGTTAAGTAGGAAATCGGG - Exonic
994643950 5:102446436-102446458 CTGAAGTTGTTTATGAAATCTGG + Intronic
994856678 5:105130593-105130615 ATAAAGCCAAGTAGGAAATCAGG - Intergenic
995006095 5:107197467-107197489 CTGATGCTAACTAGGAAATCTGG - Intergenic
996353067 5:122566972-122566994 CTGAAGATAAGTTGGAATCCAGG - Intergenic
999527887 5:152427907-152427929 CTGACATGAAGTAGGAAATTTGG - Intronic
1000684833 5:164235663-164235685 CCTAAGTGCAGTAGGAAATCAGG - Intergenic
1002937528 6:1686312-1686334 CTGCACTTAAGTATGCAATCAGG + Intronic
1004392550 6:15221709-15221731 CTGAAATCAAGTAGGAACCCTGG - Intergenic
1008749102 6:54710407-54710429 CTGAAATTAAATAGGACACCTGG - Intergenic
1012862309 6:104574326-104574348 CTGAATTTGAGTAGGAGACCTGG + Intergenic
1012968255 6:105698943-105698965 CTAAAATTAAATAGCAAATCTGG + Intergenic
1018680570 6:166261298-166261320 CTGAATTGAAGTAGGTAATTGGG - Intergenic
1019614870 7:1954642-1954664 CTGAAGTGAAGACAGAAATCGGG - Intronic
1021136588 7:16971951-16971973 CTGCAGTTAAGCAGGGAACCAGG - Intergenic
1022092909 7:27119207-27119229 CTTAAGTTAACAAGGCAATCTGG + Intronic
1022232584 7:28428540-28428562 GTGAAGATAAGTAAGAAGTCAGG + Intronic
1022704455 7:32789550-32789572 CAGGAGTTAAGGAGGAGATCGGG + Intergenic
1024001110 7:45189863-45189885 CTGAAGGGAAGAAGGAAAGCAGG + Intergenic
1024953349 7:54888751-54888773 CTTCAGTTAAATAAGAAATCAGG - Intergenic
1026341245 7:69435971-69435993 CTGCAATTAAGAAGGAAATATGG + Intergenic
1026371803 7:69707062-69707084 CTCAAGTTAAGGAGTAATTCAGG - Intronic
1030624946 7:111834074-111834096 CTGACATTAAATAGGAAATAAGG - Intronic
1031716649 7:125116701-125116723 CTGCAGTTAAGTGGCAAATCAGG + Intergenic
1032226614 7:130037065-130037087 CTGAAGTTATGAATGAGATCAGG + Intronic
1032752071 7:134851430-134851452 CAGAAGGGAAATAGGAAATCAGG + Intronic
1033867271 7:145706295-145706317 CTGAAGTTAAAGAGAAAATGAGG + Intergenic
1037212780 8:16412508-16412530 TTGAAGTTAAGTCTGAACTCAGG + Intronic
1038716751 8:29998057-29998079 CTAAAGTTAAGTAGGAATGTGGG + Intergenic
1039017548 8:33168837-33168859 CCTAAGTTAATTAGGACATCTGG - Intergenic
1039121087 8:34146886-34146908 TGGAAGCTGAGTAGGAAATCCGG + Intergenic
1039524345 8:38200424-38200446 CTGAAGTAAAATTTGAAATCAGG + Intronic
1040656383 8:49514758-49514780 ATAAAGTTAAGCAGGACATCTGG + Intergenic
1040960969 8:53032394-53032416 CTGATGTTAAGTTGGAAGTGGGG + Intergenic
1045151789 8:99416278-99416300 CTGAAGTCAAGCTGGAACTCTGG - Intronic
1046341329 8:112860468-112860490 AAGAAGTTAAGTAGTAAATGGGG - Intronic
1046609230 8:116405556-116405578 TGGAAGTCAAGAAGGAAATCTGG + Intergenic
1046796055 8:118373384-118373406 CTGAACTGAAGTAGGCCATCTGG - Intronic
1047012992 8:120692518-120692540 CTGAACTAAAGTAAGAATTCTGG + Intronic
1047865137 8:129015228-129015250 CTGTAGTTCAGTTGGAAGTCAGG + Intergenic
1048729029 8:137417645-137417667 CTTAGTTTTAGTAGGAAATCTGG - Intergenic
1048772487 8:137909776-137909798 CTGAAATGTTGTAGGAAATCTGG + Intergenic
1052766216 9:32644152-32644174 TTGAAGTTTAGTATGAAATTTGG - Intergenic
1054605774 9:67176182-67176204 CTGCAGTTGAGTAGCAACTCTGG - Intergenic
1054910409 9:70450113-70450135 CTGAAGACCAGTAGGAAAACTGG + Intergenic
1055798284 9:80000625-80000647 CTGAATTTAAGAAGGAGATCTGG - Intergenic
1056780426 9:89545163-89545185 CTGAAGGCAAATAGGAAAGCTGG + Intergenic
1057964143 9:99487170-99487192 GAGAAGTTAAATCGGAAATCTGG - Intergenic
1061556835 9:131375726-131375748 CTGATGTTAAGGATGAAATTCGG + Intergenic
1185970708 X:4659435-4659457 CTGAAAATAACTAGAAAATCTGG + Intergenic
1187264202 X:17716450-17716472 CTCATGTTAAGTAGGAAAAAAGG - Intronic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1189480671 X:41390060-41390082 CTGAAGTGCAGCAGGAAAACTGG + Intergenic
1192017052 X:67342431-67342453 TTGAACTTGTGTAGGAAATCTGG + Intergenic
1192102570 X:68279744-68279766 CTGGAATTAAGTGGGAAATAGGG + Intronic
1192490931 X:71577121-71577143 CTGTATTTAGGTAGGCAATCTGG + Intergenic
1194284289 X:91990668-91990690 CAGAAGTTGAGTGGGAAATTGGG - Intronic
1194585056 X:95722039-95722061 CTGAATTTAAATAGTAATTCAGG - Intergenic
1196062934 X:111430799-111430821 CTGTGGTTAATTAGGAGATCAGG - Intergenic
1196720783 X:118851748-118851770 CTGAAGTTGATTTAGAAATCTGG - Intergenic
1199040933 X:143115141-143115163 CATAAATTAAGTAAGAAATCAGG - Intergenic
1200601857 Y:5215227-5215249 CAGAAGTTGAGTGGGAAATTGGG - Intronic