ID: 991977884

View in Genome Browser
Species Human (GRCh38)
Location 5:72200439-72200461
Sequence TTCCCAGTACAAAGCCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991977884 Original CRISPR TTCCCAGTACAAAGCCAAAC AGG (reversed) Intronic
902178541 1:14670011-14670033 TCCCCTGTACAATGGCAAACTGG + Intronic
905581728 1:39087444-39087466 TTCAGTCTACAAAGCCAAACAGG + Intronic
908363045 1:63388907-63388929 TTCTCAGTAGAAAGCCACACAGG - Intronic
909624062 1:77696106-77696128 TTCCAAGTACAAAAACATACTGG - Exonic
911305433 1:96226144-96226166 TTCCCAGAACACAGGCAATCAGG + Intergenic
912485107 1:110020885-110020907 TTCCCAGTATTAAACCAAGCAGG + Intronic
912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG + Intergenic
918145501 1:181752508-181752530 GCCCCAGGACAAAGCCACACAGG - Intronic
919568786 1:199220951-199220973 TTCCCAGGACTGAGCTAAACAGG - Intergenic
919775712 1:201192776-201192798 TTCCCATTCCAAAGCCAATGGGG + Intronic
921758014 1:218881817-218881839 TGCCAAGTGCAAAGCCAAAGAGG - Intergenic
921952548 1:220945560-220945582 TTCCCAGTCCTAAGTCAAAAAGG - Intergenic
923888687 1:238187000-238187022 GTCCCAGTGCAAAGACAATCAGG + Intergenic
1064423586 10:15210834-15210856 TTCCCCCTTAAAAGCCAAACAGG + Intergenic
1065886732 10:30084571-30084593 TTCCCAGTTCAAAGGCAGTCAGG - Intronic
1068324065 10:55460834-55460856 GTCCCAGAACAAAGCCCAAGTGG - Intronic
1070539410 10:77405726-77405748 TTCCCAAGGCAAAGCCACACTGG + Intronic
1071829532 10:89357925-89357947 TTACCAGCACAAAACCAAACAGG - Intronic
1071942598 10:90606430-90606452 TCACCATTACAAAGCCAAATAGG - Intergenic
1073893053 10:108122882-108122904 TTCCTTGTATAAAGCCAAATTGG + Intergenic
1081565906 11:44261163-44261185 TGTCCAGTGCAAAGGCAAACAGG - Exonic
1082171890 11:49014824-49014846 TTCCCAGAAAAAAACAAAACAGG - Intergenic
1084058954 11:66656960-66656982 TTACCAGTACATTGTCAAACTGG - Intronic
1085684999 11:78613466-78613488 GTCCCAGTTCAAAGGCAGACAGG - Intergenic
1087310464 11:96535983-96536005 TTCCCAATGGAAAGCCTAACTGG - Intergenic
1093261439 12:16942072-16942094 TTCCCAGGACAAATTCAACCTGG + Intergenic
1094151818 12:27293259-27293281 TTCCCAGAATGAAGCCAAATTGG - Intronic
1095152794 12:38815133-38815155 ATCCTACTACAGAGCCAAACAGG + Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100326733 12:93546614-93546636 AACCCAGTATAAAGCAAAACAGG - Intergenic
1100372528 12:93981442-93981464 TCCCCAGTCCAATGCCAAATAGG - Intergenic
1101701401 12:107177759-107177781 GTCCCAGTTCAAAGGCAATCAGG + Intergenic
1103898570 12:124291145-124291167 TCCTAAGTAGAAAGCCAAACTGG - Intronic
1104446584 12:128838789-128838811 TTCCCAGAACATAGCCAACACGG - Intergenic
1105819501 13:24067024-24067046 TACCCAGTTCAGAGCTAAACTGG + Intronic
1113217867 13:108063334-108063356 TTCCCAGAAAAAACCCCAACTGG - Intergenic
1113312848 13:109149031-109149053 TTCCAGGTACAAAGCCTATCAGG - Intronic
1114968833 14:28000931-28000953 GTCGCAGTAGAAAGCAAAACTGG + Intergenic
1118884053 14:69851939-69851961 TTTCCAGTAGAAAGTCAATCTGG - Intergenic
1119556072 14:75553608-75553630 TTCCCAACACAAAGCAAAGCTGG - Intergenic
1127014314 15:54666164-54666186 TTCCCCGTACACAGCTAATCTGG - Intergenic
1127247701 15:57195690-57195712 TTCCCAGTCCAAAGTTAAATGGG + Intronic
1127359655 15:58233920-58233942 TTCCCTGAACAAACCCACACCGG - Intronic
1127531701 15:59850001-59850023 TCTCCAGTACAAAGCAAAGCAGG - Intergenic
1127655197 15:61048942-61048964 TCCCCAGTACAAAGGCATAGCGG - Intronic
1128503004 15:68241957-68241979 TACCCAATAAAAAGCAAAACAGG + Intronic
1129500940 15:76037440-76037462 GTCACAGTATAAAGCAAAACTGG + Intronic
1132246877 15:100304117-100304139 TTCCCAGAACAAAGGCAACCAGG + Intronic
1133678129 16:8095193-8095215 TTCCCAGTTCAAAGGCAGGCAGG + Intergenic
1134153651 16:11824681-11824703 TTCTCAGTGAAAAGCCCAACCGG - Intergenic
1140767267 16:78171924-78171946 TACCTAGTACAAAGACAAATAGG - Intronic
1141017063 16:80460633-80460655 TTCCCAGGAGAAAGCAAACCTGG + Intergenic
1142559917 17:803717-803739 TGCCAAGTACAAAGCCAAAGAGG - Exonic
1144156843 17:12512412-12512434 TTCCCATTACAAAGACAGAGTGG - Intergenic
1144421283 17:15101430-15101452 TTCCCAGAACAAACACAACCTGG - Intergenic
1145771765 17:27498447-27498469 TTCCAAGTAAAAAGCCCAATGGG + Intronic
1146114725 17:30124856-30124878 TTCTCAGTAAAAAGACAAGCTGG - Intronic
1146115131 17:30129620-30129642 TTACCAATAGTAAGCCAAACAGG - Intronic
1151473440 17:74331875-74331897 TCCCCATTAAAAATCCAAACCGG - Intronic
1151760955 17:76103051-76103073 TGCCCAGTACCTAGCCCAACTGG + Intronic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1154930134 18:20985657-20985679 TTCCTAGCACAGAGCCAAATAGG + Intronic
1155871877 18:31040614-31040636 TTCCCAGTAAGCAGCCCAACAGG - Intronic
1156545403 18:37958909-37958931 TTCCCAGTTCAGGGCCACACTGG + Intergenic
1156874207 18:41987076-41987098 TTGACAGTATAAAGCAAAACTGG - Intronic
1163585859 19:18163087-18163109 GGCCCAGTACAATGCCAAGCTGG + Exonic
932460905 2:71881281-71881303 CTCCCAGACCAGAGCCAAACTGG + Intergenic
934308629 2:91844620-91844642 TTCCCAGCTCAGTGCCAAACAGG + Intergenic
937502464 2:122494704-122494726 TTTCCAGTCCAAATCCAAATTGG - Intergenic
940297115 2:152138108-152138130 TTTCCAGTTCAAATCCCAACAGG - Intronic
942079968 2:172390900-172390922 TTCCCAGAACATTTCCAAACAGG - Intergenic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
943834188 2:192498869-192498891 TTCCCGGTGCAAAGCCCAGCTGG - Intergenic
944713434 2:202356474-202356496 TTCCCAGTACTAAGTAAAACTGG + Intergenic
945540387 2:211079065-211079087 TTTCCAGTACAATGCCAGGCAGG - Intergenic
945771160 2:214044779-214044801 GTCACAGCACAAAGCAAAACTGG + Intronic
946058328 2:216920128-216920150 TTCCCTGTACACATCAAAACAGG - Intergenic
946910793 2:224458708-224458730 CTCCCAGTACATAGCCCTACAGG + Intergenic
947104475 2:226654192-226654214 GTCCCAGTTCAAAGGCAATCTGG - Intergenic
947112963 2:226739257-226739279 CACCCTGTACAAAGACAAACAGG - Intronic
947199533 2:227602038-227602060 TTCCTAGTCCAACGTCAAACAGG - Intergenic
1170872205 20:20216461-20216483 CTCCAAATACAAAACCAAACAGG - Intronic
1172633247 20:36393018-36393040 TTCCCAGTCCTCAGCCCAACTGG - Intronic
1172954248 20:38744360-38744382 GTCCCAGTCCAAAGCCATTCAGG + Intergenic
1173110082 20:40178726-40178748 TTCCTAGAACAGTGCCAAACAGG - Intergenic
1174199429 20:48797247-48797269 TCCCCAGAAAAAAGCCAAATGGG + Intronic
1180535714 22:16391699-16391721 TTCCCAGCTCAGTGCCAAACAGG + Intergenic
1181917337 22:26291872-26291894 TTCCCAGTACATATACAACCAGG + Intronic
1182810311 22:33110683-33110705 TTCCAAGTCCAAGTCCAAACTGG + Intergenic
953141173 3:40230737-40230759 TTCCCAGTGGAAAGCAAAATGGG + Intronic
953842150 3:46397519-46397541 TTCCCACTGCAAGGCCAGACAGG + Intergenic
956499913 3:69871163-69871185 ATCCGAGAAGAAAGCCAAACTGG - Intronic
957449757 3:80364456-80364478 ATCCCAGAAGAAAGCGAAACAGG - Intergenic
957779041 3:84794517-84794539 TCCAGAGTTCAAAGCCAAACTGG + Intergenic
958432989 3:94063834-94063856 TTCCCAGTTCAAGACCAGACTGG - Intronic
959912000 3:111773946-111773968 GTACCAGGAAAAAGCCAAACTGG + Intronic
960954815 3:123024859-123024881 TTGGGAGTTCAAAGCCAAACTGG - Intronic
961354706 3:126329671-126329693 ATTCCAGTACAAATCCAAAGAGG - Intergenic
962852628 3:139319302-139319324 TTCCCAGGACAAAGCCATTGAGG - Intronic
968036286 3:195550862-195550884 TTCCTAGCACAGAGCCAAATGGG - Intergenic
969422541 4:7105661-7105683 TTCCCAAAACAAAGACAAAACGG - Intergenic
970160511 4:13183891-13183913 TTTCCAGTCCAAAGGCCAACAGG - Intergenic
970698387 4:18705371-18705393 TTCCCTGTATAAACCCTAACTGG + Intergenic
971371627 4:26024003-26024025 TTCCAAGTACACTGCCAATCAGG + Intergenic
972993791 4:44853809-44853831 TTCAGAGTAAAAAGCAAAACTGG - Intergenic
975629305 4:76383394-76383416 CTCCCAATACAAGGCCAAATGGG - Intronic
985061903 4:186088501-186088523 TTCACAGTCCAAAGCCAGGCTGG + Intergenic
989093198 5:37755873-37755895 TTCCCAGTATCAAGTCCAACAGG - Intergenic
989706593 5:44340055-44340077 TTGCCACTACTAAGCCAAAGTGG + Intronic
991114230 5:62935599-62935621 TTCCCATTTGATAGCCAAACTGG + Intergenic
991977884 5:72200439-72200461 TTCCCAGTACAAAGCCAAACAGG - Intronic
997841988 5:137250209-137250231 TTCCCTCTACAAGGCCAAATTGG + Intronic
999394035 5:151215173-151215195 CTCCCAGTCCAATGGCAAACTGG + Intronic
1003499677 6:6694243-6694265 TGCCCAGTCCAAGGGCAAACTGG + Intergenic
1004192617 6:13477379-13477401 TTTCCAGTACAAAGGCAGTCTGG + Intronic
1004801512 6:19153633-19153655 TTCCCAGAACACAGACCAACTGG - Intergenic
1011215176 6:84998056-84998078 TTCCCAGTTCAAAGGACAACTGG + Intergenic
1016601329 6:145864727-145864749 TTCCAAGTAAAAAGCCCAAAGGG + Intronic
1024405345 7:48972890-48972912 TTCCCAGTACTATGCTGAACAGG - Intergenic
1024459064 7:49641170-49641192 TTCCTGGTACAAAGGCAAAATGG - Intergenic
1026362813 7:69618349-69618371 TTGCCAGTACTGAGCCAGACTGG - Intronic
1027685447 7:81274418-81274440 TTCATGGTAGAAAGCCAAACTGG - Intergenic
1030787401 7:113679417-113679439 TTCCCAGTGAAAAGACAAAAGGG + Intergenic
1031121107 7:117723540-117723562 TTCCCAAAACAAATCCAAATTGG - Intronic
1032322974 7:130901173-130901195 TCCCCAGAACAAGGCAAAACTGG + Intergenic
1032790185 7:135237015-135237037 TTCCCAGTCCCAGGCCACACTGG - Intronic
1033894627 7:146055304-146055326 TTCCCTGTTCAAAGACAAAGAGG + Intergenic
1034679889 7:152920597-152920619 TTCCCAATACAAGATCAAACTGG - Intergenic
1038669068 8:29567148-29567170 GTCCCAGTTCAAAGGCAATCAGG + Intergenic
1041517782 8:58720450-58720472 TTCCCAGAAAAAATTCAAACTGG - Intergenic
1041862604 8:62531477-62531499 TTCTCAGTAGAAAGCCACACTGG + Intronic
1044065739 8:87698075-87698097 TTCCCATTACATAGTCAACCTGG - Intergenic
1044844010 8:96362642-96362664 TCCCTAGTACCAAGCCAAAGAGG + Intergenic
1045407014 8:101876910-101876932 CTTCCAGTACAAAGCAAAAGTGG + Intronic
1047329199 8:123870707-123870729 TTCACATTACAGAACCAAACAGG - Intronic
1049486792 8:142869277-142869299 TTCCCAGTGCAAAGTCACCCTGG + Intronic
1055034563 9:71804624-71804646 TTCCCTGTACAAAGCAAAAGTGG + Intronic
1190922887 X:54873178-54873200 TTCTCAGTATAAACCCCAACTGG + Intergenic
1193472461 X:81923974-81923996 TTCCCAGACCAAAGACATACTGG + Intergenic
1194998622 X:100619862-100619884 TTCCCAGAATAAATCCCAACTGG - Intergenic
1195746856 X:108127287-108127309 TTCCCAGCGTAAAGCCACACAGG + Intronic
1196520721 X:116667925-116667947 TTCCCAGTGCAAAGCCCAGATGG + Intergenic
1197782841 X:130174128-130174150 ACCCCAGTACTTAGCCAAACTGG + Intronic
1198767919 X:140097108-140097130 TTGCAAATACAAAGCCAAAAGGG + Intergenic
1199295426 X:146152549-146152571 TTCCCAGTTCAAAGGCCATCAGG - Intergenic
1201893180 Y:18964997-18965019 TTCCCTGTCCAAAGCAAAATAGG - Intergenic