ID: 991979121

View in Genome Browser
Species Human (GRCh38)
Location 5:72213158-72213180
Sequence GGATTTTAAATGCTGGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991979121_991979124 -2 Left 991979121 5:72213158-72213180 CCTTGATCCAGCATTTAAAATCC No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991979121 Original CRISPR GGATTTTAAATGCTGGATCA AGG (reversed) Intergenic
No off target data available for this crispr