ID: 991979124

View in Genome Browser
Species Human (GRCh38)
Location 5:72213179-72213201
Sequence CCATGATGAAATTTATTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991979122_991979124 -9 Left 991979122 5:72213165-72213187 CCAGCATTTAAAATCCATGATGA No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data
991979121_991979124 -2 Left 991979121 5:72213158-72213180 CCTTGATCCAGCATTTAAAATCC No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data
991979120_991979124 22 Left 991979120 5:72213134-72213156 CCTTTTATACATCTTCATCATAG No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data
991979118_991979124 24 Left 991979118 5:72213132-72213154 CCCCTTTTATACATCTTCATCAT No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data
991979119_991979124 23 Left 991979119 5:72213133-72213155 CCCTTTTATACATCTTCATCATA No data
Right 991979124 5:72213179-72213201 CCATGATGAAATTTATTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991979124 Original CRISPR CCATGATGAAATTTATTTTC AGG Intergenic
No off target data available for this crispr