ID: 991982129

View in Genome Browser
Species Human (GRCh38)
Location 5:72243103-72243125
Sequence GGGTAGACAGAGATGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 905
Summary {0: 1, 1: 1, 2: 5, 3: 92, 4: 806}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991982118_991982129 22 Left 991982118 5:72243058-72243080 CCTGTGGCAACAGGCTTTACAGA 0: 1
1: 0
2: 0
3: 16
4: 157
Right 991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG 0: 1
1: 1
2: 5
3: 92
4: 806
991982124_991982129 -7 Left 991982124 5:72243087-72243109 CCTCAGCCACGGAGCTGGGTAGA 0: 1
1: 0
2: 0
3: 23
4: 169
Right 991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG 0: 1
1: 1
2: 5
3: 92
4: 806

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991982129 Original CRISPR GGGTAGACAGAGATGGGAGA GGG Intronic
900342075 1:2194210-2194232 GGGCAGAGAGAGCGGGGAGATGG + Intronic
901095388 1:6674893-6674915 GGGTAGTCAGTGAAGGGTGAAGG - Intronic
901151309 1:7104660-7104682 GAGCACACAGAGATGGGAGTGGG - Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901861830 1:12079457-12079479 GGGAAGAGAGAGAGGGGAGCTGG - Intronic
902439561 1:16420654-16420676 GGGGAGACAGCCATGGGAGCAGG + Intronic
902563463 1:17294112-17294134 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
902712607 1:18250499-18250521 GGAGAGACAGCGATGGGTGACGG - Intronic
902992433 1:20197615-20197637 GGGCAGTCAGAGATGGGGGCAGG + Intergenic
903147868 1:21387055-21387077 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
903772150 1:25770724-25770746 GGGCAGACAGAGAGGGGAGAAGG - Intronic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
905386609 1:37608765-37608787 GGGAACACAGAGATGGAAGATGG + Intergenic
905514293 1:38550537-38550559 CAGTAGACAGAGAGCGGAGATGG + Intergenic
905662774 1:39740016-39740038 GGGTGGGCAGAGATGAGAGGGGG + Intronic
906057181 1:42926504-42926526 GGGTAGGAAGAGATGGGAAGGGG + Exonic
906074701 1:43043490-43043512 GGGTTGACATAGTTGGCAGATGG + Intergenic
906371110 1:45254605-45254627 GGGCAGACAGAGTTGGAAGAGGG + Intronic
906537038 1:46556738-46556760 GGGATGGCAGAGAGGGGAGATGG - Intergenic
906604935 1:47161906-47161928 GGGGAGGCAGAGATGGGTGGTGG + Intergenic
907075221 1:51572036-51572058 GAGTAGAGAGAAATTGGAGACGG - Intergenic
907229788 1:52985669-52985691 AGGAAGTCAGAGATGGGAGTGGG - Intronic
907303678 1:53502648-53502670 GGAGAGACAGAGAGGGGAGCGGG + Intergenic
907303686 1:53502673-53502695 GGGCAGGCAGAGATGAGAGGGGG + Intergenic
907753887 1:57290523-57290545 GGGTAAACAGGGATGGGGAAGGG + Intronic
907884381 1:58579273-58579295 GGGTGGACCGAGGTCGGAGAGGG - Intergenic
907922861 1:58929580-58929602 GAGTAGTCAAAGCTGGGAGAGGG + Intergenic
907944264 1:59119615-59119637 TGGGAGACAGAGATGGGGGATGG - Intergenic
908173524 1:61531174-61531196 AGGTGAACAGAGATGGGAAAAGG + Intergenic
908207441 1:61865482-61865504 CGGGAGGCCGAGATGGGAGATGG - Intronic
909070299 1:70985647-70985669 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
909455053 1:75840898-75840920 GGGAACACAGAGAAGGGAGTTGG + Intronic
910005830 1:82396010-82396032 GAGAAGCCAGAGAAGGGAGAAGG - Intergenic
910076976 1:83292325-83292347 GGACAGACAGAGATTGGAGTTGG + Intergenic
911735777 1:101335159-101335181 GGGTAGACAAAAATGAGAGAAGG + Intergenic
912652246 1:111449639-111449661 GGGGTGACAGGGAGGGGAGAAGG + Intronic
912656438 1:111490122-111490144 GGTCAGACAGAGCTGGGAAAAGG + Intronic
913233870 1:116764005-116764027 GGGTAGCCAGAGACGAGAGCAGG + Intronic
913361396 1:117984397-117984419 GGCTTAACATAGATGGGAGAGGG + Intronic
914220764 1:145679978-145680000 AAGTAGACAGAGCTGGGATAAGG - Intronic
914473339 1:148002851-148002873 AAGTAGACAGAGCTGGGATAAGG - Intergenic
914720748 1:150286842-150286864 GGGTAGACTGGGAGGGGATAGGG - Exonic
914879246 1:151535142-151535164 GGGTAAACAGAGATGAGGGGTGG - Intronic
915062172 1:153195226-153195248 TGGAAGAAAGAGATTGGAGAGGG - Intergenic
915342518 1:155184313-155184335 GGGAAGACAGACACGGGAGAAGG - Exonic
917309402 1:173662878-173662900 AGGTAGACAGGGATTGGAAATGG + Intronic
917496193 1:175542221-175542243 GGAGAGACAGAGCTGAGAGAGGG - Intronic
917789422 1:178490009-178490031 GGATAGAATGAGATGGGAAATGG - Intergenic
919092164 1:192989079-192989101 GGAAAGAGTGAGATGGGAGAAGG + Intergenic
919144848 1:193621156-193621178 GGTGAGCCAGGGATGGGAGAAGG + Intergenic
919986466 1:202679207-202679229 AGGGAGACAGAGAAGGGAGTCGG - Intronic
919988405 1:202691772-202691794 AGAGAGAGAGAGATGGGAGAGGG + Intronic
920367537 1:205455989-205456011 GGGAAGAAAGAGATTGGTGAGGG - Intergenic
920948676 1:210553122-210553144 GGGGAGAGGAAGATGGGAGATGG + Intronic
921079554 1:211727614-211727636 GGCAAGAGAGAGAAGGGAGAAGG - Intergenic
921082195 1:211750328-211750350 AGATAAACAGAGATGGGAGGGGG - Intronic
921307252 1:213809221-213809243 GAGGAGACAGAGATGAGGGATGG + Intergenic
921525350 1:216210449-216210471 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
922742081 1:228019715-228019737 GGATAGATAGAGAATGGAGAGGG - Intronic
922963367 1:229666883-229666905 GGGCAGACAGAGCTGTGAGCTGG + Intergenic
923140727 1:231160362-231160384 CAGTAGCCACAGATGGGAGATGG - Intergenic
923142701 1:231174600-231174622 GTGGAGACAGAGAAGGGAGAGGG - Intronic
923818457 1:237406228-237406250 ACGTATAAAGAGATGGGAGAGGG - Intronic
924903879 1:248431926-248431948 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
924923990 1:248660079-248660101 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1063133628 10:3198524-3198546 GGAGAGACAGAGAGAGGAGAGGG + Intergenic
1063368353 10:5505013-5505035 GGATAATCAGGGATGGGAGATGG - Intergenic
1063502945 10:6571099-6571121 GGGAAGACAGAGATCCTAGATGG + Intronic
1064005636 10:11696806-11696828 GGGTAGAGAGAGAAAGGTGAAGG - Intergenic
1064103756 10:12484458-12484480 AGGAAGGCAGAGATCGGAGATGG + Intronic
1064218012 10:13416738-13416760 GGGGTGACAGAGGAGGGAGAAGG + Intergenic
1064245087 10:13661761-13661783 GGGAAGGCAGACATGGGAGGTGG + Intronic
1064428817 10:15254148-15254170 GGGTGGACACAGATGGCAGAGGG + Intronic
1064473314 10:15659766-15659788 ATGTAGACAGAGAGGGCAGAAGG + Intronic
1064478671 10:15719124-15719146 GGGTACAGTGAGATGAGAGAAGG + Intronic
1064745569 10:18475106-18475128 GAGGAGAGAGGGATGGGAGAGGG + Intronic
1064949087 10:20827058-20827080 GGGTGGAGACACATGGGAGAGGG - Intronic
1066379531 10:34889471-34889493 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1067459218 10:46445069-46445091 AGGTAGACGGAGACTGGAGAAGG + Intergenic
1067627978 10:47939561-47939583 AGGTAGACGGAGACTGGAGAAGG - Intergenic
1067706936 10:48613082-48613104 GTGTACACTGAGATGGGAGCTGG - Intronic
1068031435 10:51709838-51709860 GGGGAGGCAGAGATGAGGGAGGG + Intronic
1068120569 10:52779278-52779300 AGGGAGACAGAGATGGGAGGAGG - Intergenic
1068504926 10:57888450-57888472 TGGTAGACAGACATGCGATATGG + Intergenic
1068544614 10:58331767-58331789 GGGAAGACAGAGAAAAGAGAAGG - Intergenic
1068625115 10:59236424-59236446 GGGGAGACAGAGAGGGACGAAGG - Intronic
1069547434 10:69338785-69338807 GTGTAGAGAGAGAGGGAAGAGGG + Intronic
1069649608 10:70035868-70035890 TGGGAGACAGAAAAGGGAGAGGG + Intergenic
1070093641 10:73314156-73314178 GGGTGGACAGAGGTGGGCAAAGG + Intronic
1070421749 10:76244295-76244317 GGGTAGGAGGTGATGGGAGAAGG - Intronic
1071379766 10:85046647-85046669 AGGGAGACAGATATGGGAGAAGG + Intergenic
1071495444 10:86164688-86164710 GGGTACAGAGAGGTGGGAGAGGG + Intronic
1071605156 10:86980731-86980753 GGGAACACAGAGCTAGGAGAAGG - Intronic
1072168899 10:92841208-92841230 GGAGAGACATAGATGGGAAAAGG - Intronic
1072180135 10:92974548-92974570 GGGGAGAGGGAGACGGGAGAGGG - Intronic
1072237629 10:93466732-93466754 GGGAGGCCAGAGGTGGGAGATGG + Intronic
1072307399 10:94120795-94120817 GGGAAGAGAGAGAGGGGTGATGG + Intronic
1073112793 10:101072493-101072515 AGGCAGAGAGAGATGGGAAAAGG + Intergenic
1073238060 10:102035385-102035407 GGGGAGAGGGAGAAGGGAGAAGG - Intronic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1074603861 10:114941064-114941086 GAGTGGACAGAGAAGGGAGGAGG - Intronic
1075098620 10:119490221-119490243 GGGAAGCCAGAGAAGTGAGAGGG - Intergenic
1075173615 10:120139104-120139126 GAGTAGAAACAGAAGGGAGAGGG - Intergenic
1075198103 10:120378579-120378601 GGGAAGGAAGAGATGGGACAGGG + Intergenic
1075246064 10:120823122-120823144 GATTAGGCAGAGATGGGAGTGGG + Intergenic
1075307943 10:121384496-121384518 GGGTAACCAGGGATGAGAGAGGG + Intergenic
1075399744 10:122152180-122152202 ATTTAGACAGAGATGGGAGCAGG - Intronic
1075603371 10:123787202-123787224 GTGCAGACAGAGATGGAAAAGGG + Intronic
1076330888 10:129665278-129665300 GGAGAGAGAGAGTTGGGAGAGGG - Intronic
1077017459 11:403316-403338 GGGGGGACAGAGGAGGGAGAGGG + Intronic
1077353837 11:2105593-2105615 GGGCAGAGACAGATGGGACAGGG - Intergenic
1077485721 11:2837604-2837626 GGGCAGACAGAGGTGGGGGATGG + Intronic
1077612689 11:3653780-3653802 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612697 11:3653843-3653865 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612705 11:3653906-3653928 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612728 11:3654095-3654117 GGATAGACAGAGGTAGGAGTTGG - Intronic
1077612735 11:3654158-3654180 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612743 11:3654221-3654243 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612751 11:3654284-3654306 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612767 11:3654410-3654432 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612791 11:3654599-3654621 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612799 11:3654662-3654684 GGATAGACAGAGGTAGGAGGTGG - Intronic
1077612807 11:3654725-3654747 GGATAGACAGAGGTAGGAGGTGG - Intronic
1078710956 11:13790423-13790445 GAGTATACAGTGTTGGGAGAGGG + Intergenic
1078972899 11:16435809-16435831 GGAAAGAAAGAGAAGGGAGAAGG - Intronic
1079154716 11:17935063-17935085 GGAAAGTCAGGGATGGGAGAAGG - Intronic
1079282859 11:19103576-19103598 GGGTAGGTAGAGAGTGGAGAGGG - Intergenic
1079622049 11:22567073-22567095 GGGTTCACAGAGAAGAGAGATGG + Intergenic
1080382537 11:31788454-31788476 AGGGAGACAGAAAAGGGAGAGGG + Exonic
1080494865 11:32807056-32807078 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1080790340 11:35516953-35516975 GGGAAAAAAGAGGTGGGAGAAGG + Intronic
1081553851 11:44139597-44139619 GGCTAGAAAGAAATGGGGGAAGG - Intronic
1081580899 11:44350959-44350981 GGCATGTCAGAGATGGGAGAAGG + Intergenic
1081591019 11:44423303-44423325 GAGGAAACAGAGATCGGAGAAGG - Intergenic
1081607399 11:44535984-44536006 GGACAGGCAGAGATGGGAGTGGG + Intergenic
1081638997 11:44740120-44740142 GGGCGGGCAGAGATCGGAGAGGG - Intronic
1082030406 11:47599459-47599481 AGGAAGAGACAGATGGGAGAGGG + Intergenic
1082257466 11:50047576-50047598 GTGTGGCCAGAGATGGGAAATGG - Intergenic
1082877589 11:58003571-58003593 GGGTGGACAGAGCAGGGGGAAGG + Intergenic
1083161320 11:60855943-60855965 GGGCAGACAGAGGTGGGAGAGGG + Exonic
1083334206 11:61913364-61913386 GGGGAGCCAGAGTAGGGAGAAGG + Intronic
1083418869 11:62542542-62542564 GGGTAGAGAGAGATGGAGAAAGG - Intronic
1084117520 11:67050680-67050702 GGGGAGGGAGAGAGGGGAGAGGG - Exonic
1084173825 11:67413198-67413220 GGGTCGGCAGAGAGGGGAAATGG - Intronic
1084234274 11:67776420-67776442 GGGTAGAAAAGGCTGGGAGAGGG - Intergenic
1084347578 11:68565557-68565579 TGGAAGACGGAGGTGGGAGAAGG + Intronic
1084388635 11:68860830-68860852 GGGGAGAGGGAGATGGGAGACGG - Intergenic
1084551550 11:69846179-69846201 GAGAAGACACAGAGGGGAGAAGG + Intergenic
1084597022 11:70123108-70123130 GAGGAGACAGGGATGGGGGAAGG + Intronic
1084780828 11:71407273-71407295 GAAGAGCCAGAGATGGGAGACGG + Intergenic
1084892110 11:72241675-72241697 GGGTAGACAGAGGGGACAGACGG - Intronic
1085142364 11:74157882-74157904 GGATATACAGAGATAAGAGATGG - Intronic
1086021509 11:82236284-82236306 GGGCAGATAGAGAGGGAAGAAGG + Intergenic
1086240937 11:84690127-84690149 GGGGAAAAAGAGATGGGAAAAGG + Intronic
1086250413 11:84805608-84805630 AGGAAGACAGAGATGGGGGGAGG - Intronic
1088073067 11:105813218-105813240 GGGTAGAGGGAAATGGGGGAAGG + Intronic
1088234190 11:107704887-107704909 GGGTAGACAGATATGTTAAATGG - Intergenic
1088329674 11:108638059-108638081 GGGAATAGAGAGATTGGAGAGGG + Intergenic
1088585252 11:111355488-111355510 GGGGAGACAGGGATGGTAGGGGG - Intronic
1089073137 11:115716698-115716720 GGGGAGACGGGGATGGGGGAGGG - Intergenic
1089258957 11:117209529-117209551 CGGTAGACAGGGTTGGTAGAGGG + Intronic
1089763750 11:120748266-120748288 GGGTGGAAGGAGATGGGAGGTGG - Intronic
1090033807 11:123230703-123230725 TGGTAGGTAGAGATGGGAAAGGG + Intergenic
1091197889 11:133747386-133747408 AGGGAGACAGAGATGGAATAAGG - Intergenic
1091214427 11:133891952-133891974 GGGTAGACAGAGAAGAGAAGGGG - Intergenic
1091225264 11:133953336-133953358 GGGGAGACGGGGATGTGAGAAGG - Intronic
1091981298 12:4866279-4866301 GGGCAGACAGGGCTGGAAGAAGG + Intergenic
1092198908 12:6567926-6567948 TGGCAGGCAGAAATGGGAGAAGG + Intronic
1092487293 12:8914188-8914210 GAGGAGAGGGAGATGGGAGAAGG - Intronic
1092676669 12:10928661-10928683 GGGTACACATAGATGACAGAAGG - Intronic
1093224773 12:16468982-16469004 TGGTAGACAGACAAGGTAGAAGG + Intronic
1093800652 12:23367740-23367762 GGGTGGACAGGAATGGAAGATGG + Intergenic
1094108395 12:26836399-26836421 GGGCATGCAGAGGTGGGAGAAGG - Intergenic
1094166172 12:27446281-27446303 GGGGAGAGAGAGATGGAGGAGGG + Intergenic
1094378721 12:29819151-29819173 GGTTAGACAAAGATGGGAGATGG - Intergenic
1094673781 12:32597964-32597986 TGGGAGGCAGAGATGGGAGGAGG - Intronic
1095477910 12:42604580-42604602 GGGTAGAGAGAGCAGGGAGGAGG - Intergenic
1096240403 12:49956755-49956777 GGGGAGAGTGAGATGGGTGATGG - Exonic
1096281370 12:50257581-50257603 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1096670733 12:53196908-53196930 GGGAGGACGGTGATGGGAGAGGG + Intronic
1096790979 12:54044755-54044777 TGGTACATAGAGATGTGAGAAGG - Intronic
1096876988 12:54637091-54637113 TGGGAGACACAGGTGGGAGATGG + Intergenic
1096980896 12:55727921-55727943 GGGGAGGGAGAGAGGGGAGAAGG + Intronic
1097191310 12:57220861-57220883 GGCAAAACAGAGATGGGGGATGG - Intronic
1097277272 12:57822065-57822087 GGGAACACAGAGATGGGAACAGG + Exonic
1097922227 12:65088624-65088646 GGAGAGATAGAGATGGGAAAGGG - Intronic
1098992541 12:77079684-77079706 GGGTAAAGAGAGAGGAGAGAAGG + Intergenic
1099133327 12:78863782-78863804 GGGTCGAGAGAGATGGGGGAGGG + Intergenic
1100699782 12:97134919-97134941 GGGAAAACAGAGATGGAAGAGGG + Intergenic
1100794659 12:98168417-98168439 GGGTAGATAGGGAAGAGAGAGGG + Intergenic
1100822083 12:98441093-98441115 GGGAAGACAGAGAGGGGTGAGGG + Intergenic
1101481125 12:105098414-105098436 GGGGAGACTGAGATGGGAACTGG - Intergenic
1101496652 12:105260817-105260839 GGGTGCACATAGATGGGAGGAGG - Intronic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102261506 12:111446058-111446080 GGGGAGAAAGAGATGAGATAAGG - Intronic
1102334701 12:112068260-112068282 CCATAGATAGAGATGGGAGAGGG + Intronic
1102521968 12:113483585-113483607 GAGTAGTAAGAGATGGGGGAAGG + Intergenic
1102959805 12:117085134-117085156 GGGTGGACAGGGCTGGCAGAAGG + Intronic
1104001702 12:124864196-124864218 GGGGAGACATAGGTGGGGGAAGG - Intronic
1104301404 12:127568389-127568411 AGGGAGAGAGAGATGAGAGAGGG + Intergenic
1104347526 12:128014847-128014869 GGTAAGACAGAGGTGGGAGAAGG + Intergenic
1104788561 12:131467412-131467434 GGGCAGACGGAGATGGGAGCAGG + Intergenic
1104947978 12:132425524-132425546 AGGGAGAGAGAGAAGGGAGATGG + Intergenic
1105274091 13:18904763-18904785 GGGTAGATGGAGGTGGGAAAGGG - Intergenic
1105372978 13:19817556-19817578 GGGTAGAAAGAGCAGGGAGCAGG + Intergenic
1105567738 13:21567576-21567598 GGGTAGAAAGAGCTAGAAGAAGG + Intronic
1105628346 13:22136213-22136235 ATGTTGACAGAGATAGGAGAAGG - Intergenic
1105940251 13:25141448-25141470 GGTTAGCCACAGATGGGAGTTGG - Intergenic
1106880352 13:34122501-34122523 GGGTAGGGAGAGATGGGTGCTGG + Intergenic
1107829360 13:44360615-44360637 GGGTTGCCAGGGATGGGAGCAGG + Intergenic
1108024262 13:46162281-46162303 GGGTTGAGGGAGACGGGAGAGGG - Intronic
1108180274 13:47833789-47833811 GGGTAAAGGGAGTTGGGAGAAGG + Intergenic
1108250513 13:48562887-48562909 TTCTAGACAGAGATGGGAAATGG - Intergenic
1109151360 13:58852366-58852388 AGGTAGACAGAAAAGGTAGAAGG + Intergenic
1109526615 13:63583673-63583695 GGATAGACAGAAAGGGGAAAGGG + Intergenic
1109594575 13:64533489-64533511 GGGTAAAGAGTGATGAGAGAGGG - Intergenic
1109978427 13:69872577-69872599 GGGGTGATAGAGAGGGGAGAGGG - Intronic
1110103050 13:71633896-71633918 GGATAGTAAGAGATTGGAGATGG - Intronic
1110552993 13:76828242-76828264 GGGGAGGCAGGGAAGGGAGAAGG + Intergenic
1110866053 13:80397786-80397808 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1111443873 13:88319673-88319695 AGAGAGAGAGAGATGGGAGATGG + Intergenic
1111487835 13:88927042-88927064 GAGGAGACAGAGGTGGCAGACGG + Intergenic
1111562288 13:89967047-89967069 TGTGAGACAGAGATGGGGGAAGG + Intergenic
1112585755 13:100716952-100716974 TGGCAGACAGGGATGAGAGACGG - Intergenic
1112837998 13:103539583-103539605 GGTTAGACAGAAAGGGGAGGGGG + Intergenic
1112958810 13:105095846-105095868 AGGTAGAAAGAGAAGGGTGAGGG + Intergenic
1113108851 13:106800109-106800131 GGGGAGGCAGAGCTGGGAGTTGG + Intergenic
1113113615 13:106850782-106850804 GGGTGGAGAAAGATGGCAGATGG - Intergenic
1113240916 13:108336056-108336078 GGGTGGAGAGAGAGAGGAGAAGG - Intergenic
1113554224 13:111218469-111218491 GGGTGGACAGAGGTGGGGGGTGG + Intronic
1113593708 13:111517663-111517685 GAGTAGTCAGGGATGGGAGAGGG - Intergenic
1113708863 13:112451499-112451521 GGGTGGACAGGGATGGGCGGAGG + Intergenic
1114050800 14:18918868-18918890 GGGTAGATGGAGAAGGGAGAGGG - Intergenic
1114069024 14:19093860-19093882 GGGAACACAGAGCTAGGAGAAGG + Intergenic
1114093236 14:19306145-19306167 GGGAACACAGAGCTAGGAGAAGG - Intergenic
1114111759 14:19483054-19483076 GGGTAGATGGAGAAGGGAGAGGG + Intergenic
1114178614 14:20345872-20345894 GGAGAGAGAGAGATTGGAGAAGG + Intronic
1114258942 14:21024215-21024237 GGGTAGACAGACACTGGGGAGGG - Exonic
1114307115 14:21433756-21433778 GGCTAGCCAGGAATGGGAGATGG - Intronic
1114655722 14:24314570-24314592 TGGTAGCCAGAGAAGGGAAATGG - Exonic
1114910742 14:27192638-27192660 GTGTACACAGAGATGAGAGAAGG + Intergenic
1115367953 14:32580444-32580466 AGGAAGACAGAGGTGAGAGAAGG - Intronic
1115429448 14:33299501-33299523 AAGTAGAAAGAGCTGGGAGATGG + Intronic
1115753931 14:36515449-36515471 GGGATGAGAGAGAGGGGAGAAGG - Intergenic
1116508337 14:45713649-45713671 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1116508620 14:45715999-45716021 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1117010790 14:51468285-51468307 GGGGAGACAGAGATGGGAGAGGG + Intergenic
1117372611 14:55092452-55092474 GAGAAGACAGAGATGAGAAACGG + Intergenic
1118440765 14:65809450-65809472 TTGTAGACAGAGATTGGAGTGGG + Intergenic
1119467039 14:74866389-74866411 ATGTAGACAGAGAAGGGAGGAGG + Intronic
1119607323 14:76031846-76031868 GTGTTGACAGAGAAGAGAGAAGG - Intronic
1119665891 14:76484704-76484726 GGTTGGTCACAGATGGGAGATGG - Intronic
1119768252 14:77204325-77204347 GGGGAGACAGAGGTGGGCAAGGG + Intronic
1119770020 14:77214657-77214679 GGGGAGACAGTGAGGGGGGAAGG - Intronic
1119849599 14:77857830-77857852 TGGTTGACTGAGATGGGAGGAGG + Intronic
1120193926 14:81463172-81463194 AGGGAGAGGGAGATGGGAGAGGG + Intergenic
1120801155 14:88690163-88690185 GGGGAGACAGTAATGGGAAATGG + Intronic
1120818054 14:88883784-88883806 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1121436511 14:93924219-93924241 AGGAACACAGGGATGGGAGAGGG + Intronic
1122387738 14:101360542-101360564 GGATACTCAGAGAAGGGAGAGGG + Intergenic
1122442087 14:101738930-101738952 GAGAACACAGAGAGGGGAGAGGG + Intergenic
1124548165 15:30651968-30651990 GGGAAGGAAGGGATGGGAGAGGG - Intronic
1124828551 15:33125010-33125032 GAGTAGACATGGATGCGAGAAGG - Intronic
1125191685 15:37001037-37001059 AGGTCGACAGAGAAGGGTGAGGG - Intronic
1125890078 15:43259073-43259095 AGGTAGAAAGAGAGGGAAGATGG + Intronic
1126118686 15:45231866-45231888 GGAGAGACAGAGAGGAGAGAGGG + Intergenic
1127023994 15:54782125-54782147 CGGGAGACGGAGATGGGAGACGG + Intergenic
1127023998 15:54782144-54782166 ACGGAGACGGAGATGGGAGACGG + Intergenic
1127024001 15:54782157-54782179 TGGGAGACGGAGACGGGAGATGG + Intergenic
1127399959 15:58575551-58575573 GGGAAGAAAGCGAGGGGAGAAGG - Intergenic
1127642862 15:60931723-60931745 GGGCAGGAAGAGATGGGACATGG + Intronic
1128218695 15:65952539-65952561 GGGTGAACAGGGATGGGAGAAGG - Intronic
1128632877 15:69283133-69283155 GAGTAGAGAGGGCTGGGAGAGGG - Intergenic
1128651625 15:69419388-69419410 GTGGAGAGACAGATGGGAGACGG - Intronic
1129064602 15:72890258-72890280 GGGGAGACAGAGAGCTGAGACGG + Intergenic
1129145085 15:73639817-73639839 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1130017712 15:80200490-80200512 GGGCAGAAAGAGGTGGGAGGAGG + Intergenic
1130300740 15:82678506-82678528 AGGGGGACAGTGATGGGAGATGG - Intronic
1131066791 15:89439711-89439733 GGGTAGATAGAGAAGGAAGAGGG - Intergenic
1131137135 15:89945887-89945909 GGGGAGAAGGAGATGGTAGAGGG + Intergenic
1131479552 15:92769334-92769356 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131479579 15:92769422-92769444 GGGGAGAGGGAGACGGGAGAGGG + Intronic
1131845918 15:96490919-96490941 GGGTTAACAGACATGGGAGCTGG + Intergenic
1131857674 15:96616147-96616169 GAGTAGAGAGAGAGAGGAGAAGG - Intergenic
1132121710 15:99181681-99181703 TGCTGGGCAGAGATGGGAGAGGG - Intronic
1132289216 15:100687782-100687804 GGGTGGACTGAAATGGGGGATGG + Intergenic
1132713210 16:1278392-1278414 GGGCACACAGAGATGGGGGAGGG - Intergenic
1133370690 16:5243573-5243595 GGGTAGCCATAGCTGGGAGGGGG - Intergenic
1133387988 16:5386263-5386285 GGGTAGATAGAGCTGGGACTGGG + Intergenic
1133495360 16:6312562-6312584 TGCTAGACAGAGATGGGGAAGGG + Intronic
1133507476 16:6426296-6426318 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1133591543 16:7249094-7249116 GGGAAGAGAGAAATGGGAGAGGG + Intronic
1133626644 16:7576036-7576058 TGGGAGACCGAGGTGGGAGATGG - Intronic
1133890873 16:9877648-9877670 GGGGAGAGAGAGGGGGGAGAGGG - Intronic
1133917757 16:10124607-10124629 GGTGAGACGGAGCTGGGAGATGG + Intronic
1134074833 16:11283308-11283330 GAGGAGACAGAGATGGGGGCGGG + Intronic
1134122740 16:11596537-11596559 GGGAGGACAGAGAGGGGAGGAGG + Intronic
1134167450 16:11941773-11941795 TGGGAGACTGAGATGGGGGAGGG - Intronic
1134325554 16:13204445-13204467 GGGTAGATGGAGATGGTAAAGGG - Intronic
1134334298 16:13283266-13283288 GGGGAGACAGAGTTAGGAGGTGG - Intergenic
1134750310 16:16619836-16619858 TGGGAGACGGAGACGGGAGAGGG + Intergenic
1134995148 16:18733762-18733784 TGGGAGACGGAGACGGGAGAGGG - Intergenic
1135312881 16:21419425-21419447 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135365804 16:21851705-21851727 TGGGAGACTGAGATGGGGGAGGG - Intronic
1135446010 16:22519457-22519479 TGGGAGACTGAGATGGGGGAGGG + Intronic
1135668596 16:24356093-24356115 GGGTAGGAAGAGATGGTAAAGGG - Intronic
1135712111 16:24726590-24726612 GGTTAAAGAGAGCTGGGAGAAGG + Intergenic
1135932118 16:26747273-26747295 GGTTAGGGAGAGATGGGAGTGGG - Intergenic
1136145426 16:28313666-28313688 GGGAAGACAGGGATGGGAGCAGG + Intronic
1136152038 16:28357156-28357178 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136168291 16:28471024-28471046 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136194710 16:28644027-28644049 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136211042 16:28758126-28758148 TGGGAGACTGAGATGGGGGAGGG + Intronic
1136255763 16:29038084-29038106 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1136309547 16:29398152-29398174 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136322994 16:29499933-29499955 TGGGAGACTGAGATGGGGGAGGG - Intronic
1136401436 16:30021433-30021455 GAGGTGGCAGAGATGGGAGATGG + Intronic
1136437678 16:30239901-30239923 TGGGAGACTGAGATGGGGGAGGG - Intronic
1137718092 16:50611187-50611209 GGAGAGAGGGAGATGGGAGAGGG - Intronic
1138219710 16:55240351-55240373 GGGTCAAAAGAGAGGGGAGAAGG - Intergenic
1138221612 16:55256363-55256385 GGGCAGACAGAGGTGGGGGCGGG + Intergenic
1138239391 16:55414787-55414809 GGGTAGACAGAACTGGAGGAAGG + Intronic
1138589242 16:57990675-57990697 GGGTAGGAAGAGGTGGGGGAAGG - Intergenic
1138978659 16:62240142-62240164 GGGTAGGGAGAGAGTGGAGAGGG - Intergenic
1139474249 16:67194655-67194677 GGGTGGTAAGGGATGGGAGATGG - Intronic
1139588092 16:67917141-67917163 GGGTTGTCATAGATTGGAGATGG - Intronic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140151853 16:72375452-72375474 GGGAAGGCAGAGATGATAGATGG + Intergenic
1140365441 16:74377389-74377411 TGGGAGACTGAGATGGGGGAGGG + Intergenic
1140452063 16:75079019-75079041 GGGTAGATAAGAATGGGAGAAGG - Intronic
1141035025 16:80619148-80619170 GGGGACACAGAGACAGGAGAAGG - Intronic
1141152228 16:81572232-81572254 TTGTAGACAGAGATGAGAAATGG - Intronic
1141164694 16:81652626-81652648 GGGAAGACAGAGATGGGGATGGG - Intronic
1141202548 16:81908966-81908988 GAGGAGACAGAGATGCTAGAAGG - Intronic
1141324996 16:83048620-83048642 GGGTACTCAGAGATGGAAAAGGG - Intronic
1141484802 16:84331655-84331677 GGGAAGGCACAGATGGGAGCAGG + Intergenic
1141855967 16:86681757-86681779 AGGGAGGGAGAGATGGGAGAAGG + Intergenic
1142867320 17:2798731-2798753 GGAGAGGCTGAGATGGGAGATGG - Intronic
1143446741 17:7014417-7014439 CGGATGCCAGAGATGGGAGAAGG - Exonic
1143863697 17:9908955-9908977 GGGGAGACAGAGAATGGGGAAGG + Intergenic
1144203795 17:12964883-12964905 GTGGAGACAGAGAGGAGAGAAGG - Intronic
1144440784 17:15279370-15279392 GGGAAGAAAGAGAAGGTAGAGGG + Intergenic
1145306440 17:21677890-21677912 AGGAAGCCAGAAATGGGAGATGG - Intergenic
1145763167 17:27439357-27439379 GTGTAGACAGAGAAGGGATGAGG - Intergenic
1145879880 17:28345221-28345243 GGGTAGAAAGACATGGGTCAAGG - Exonic
1146447561 17:32944466-32944488 GGGCACACAGAGAAGGGACAGGG + Intronic
1146691918 17:34882618-34882640 GGGGAGGCAGAGGTGGGAGTGGG - Intergenic
1146941275 17:36845984-36846006 GTGGGGACAGAGAGGGGAGAGGG + Intergenic
1147313640 17:39608483-39608505 GGGCAGACAGGGATGAGGGATGG - Intronic
1147381119 17:40056848-40056870 GGGGAGACAGAGAAGGCAGATGG - Intronic
1147383919 17:40070965-40070987 GGGGAGCCAGAGATGGGGGATGG - Intronic
1147450458 17:40500873-40500895 AGGTAGACAGGACTGGGAGATGG - Intronic
1147548029 17:41418395-41418417 GTGTAGACAGTGGTGGGAGCAGG + Intergenic
1147966810 17:44198627-44198649 GGGAAGACAGAGTGGGGTGAAGG - Intronic
1148043651 17:44728409-44728431 GGGTATACTGGGATGGGAGGAGG + Intronic
1148975097 17:51520534-51520556 GGGTAGCCCAAGATGGGAGCTGG - Intergenic
1149053570 17:52335756-52335778 GGGGAGAGAGAGAGGGGAGAGGG - Intergenic
1149658113 17:58320707-58320729 GGGTAGGGAGAGAGGGAAGAGGG + Intronic
1150120727 17:62599514-62599536 GGGAAGGCAGAAATGGGAGGGGG + Intronic
1151189492 17:72387760-72387782 GGGTGGAGAGAAGTGGGAGAGGG + Intergenic
1151350855 17:73531389-73531411 GGGTGGTCAGAGGTGGGGGAAGG - Intronic
1151769210 17:76148878-76148900 GGGTAGTCAGTGATGGAAAAAGG - Intronic
1151906913 17:77054753-77054775 GGGGAGACTGAGAGAGGAGAAGG + Intergenic
1152010497 17:77710413-77710435 GAGGGGGCAGAGATGGGAGAGGG - Intergenic
1152221926 17:79073622-79073644 GGGAGGACAGAGAAGGCAGAGGG - Intergenic
1152371130 17:79889243-79889265 GGGGAGACAGAGGGGTGAGAAGG - Intergenic
1152460412 17:80439366-80439388 GGGGAGACAGGGATGGGTGAGGG - Intergenic
1152678352 17:81653139-81653161 GGGTAAGCAGAGCTGGGGGATGG - Exonic
1152870478 17:82751073-82751095 GGGGGGACGGCGATGGGAGACGG - Exonic
1153174666 18:2357450-2357472 AGGCAGACAGAGATGGGTGTTGG - Intergenic
1154118680 18:11633782-11633804 TGGGAGACTGAGATGGGGGAGGG - Intergenic
1154344692 18:13532086-13532108 GGGCAGTGAGAGATGGGAGCAGG + Intronic
1155401908 18:25448366-25448388 GGGAAGCCAGAGATGGCAGGAGG + Intergenic
1155494617 18:26430438-26430460 GGGGAGAGAGGGATGGGAAATGG - Intergenic
1155718258 18:28973918-28973940 GGGTACAGTCAGATGGGAGATGG + Intergenic
1156152421 18:34258308-34258330 GGTTAGACAGAGAAGCTAGAGGG + Intergenic
1156216831 18:35007700-35007722 GGATATAGAGAGAAGGGAGAGGG - Intronic
1156227041 18:35119340-35119362 GGGTAGACAGAGCTGGGCTGCGG - Intronic
1157246012 18:46056059-46056081 CTGTAGAGAGAGAAGGGAGAGGG - Intronic
1157315881 18:46589302-46589324 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1157905627 18:51567470-51567492 GGAGAGACAGGGATAGGAGAGGG - Intergenic
1158098335 18:53801018-53801040 GGGTGGACGGTGGTGGGAGAAGG - Intergenic
1158102959 18:53851408-53851430 GTGTGGACAGAGATGAGAGATGG - Intergenic
1158996089 18:62921403-62921425 GGAGAGACAGAGATCGCAGACGG - Intronic
1159834502 18:73321860-73321882 GGTTAGTAAGAGATGAGAGATGG - Intergenic
1160482779 18:79257722-79257744 TGCTGGACAGAGATGGGAGCAGG - Intronic
1160738192 19:674314-674336 GGGAAGACAGAGCCGGGAGCAGG + Intergenic
1160827085 19:1085613-1085635 GGGGAGACAGACAGGAGAGATGG - Intronic
1160961094 19:1721196-1721218 GGGAAGACAGAGCCAGGAGAGGG + Intergenic
1160983274 19:1826462-1826484 GAAGAGACAGAGATGGGGGAAGG + Intronic
1161035153 19:2080262-2080284 GGGGAGTCAGAGAGGGGAGAGGG + Intronic
1161090943 19:2359963-2359985 GGGTAGCCAGGGATGGGAGTGGG - Intergenic
1161664466 19:5566841-5566863 GGGGAGACAGAGACCAGAGAGGG + Intergenic
1161664490 19:5567167-5567189 AGGGAGACAGAGATAAGAGATGG + Intergenic
1162333057 19:10042231-10042253 GGGAAGACTGAGAGTGGAGAGGG - Intergenic
1162620958 19:11843863-11843885 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1162720603 19:12659970-12659992 GGGGTGTCTGAGATGGGAGAGGG + Intronic
1163223067 19:15935493-15935515 AGGAGGACAGAGAGGGGAGATGG + Intergenic
1164013766 19:21234044-21234066 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1164014219 19:21237883-21237905 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1165353838 19:35291916-35291938 GGGTGTACAGGGATGGAAGATGG + Intergenic
1165702493 19:37949168-37949190 GAAGAGACAGAGATGGGAGATGG - Intronic
1165724176 19:38100998-38101020 GGCCAGGCAGAGATGGCAGAGGG - Intronic
1166048781 19:40245743-40245765 GGGTGGACATAGATGGGTTATGG - Intronic
1166214293 19:41325517-41325539 GGGAGGAGAGAGAGGGGAGACGG - Intronic
1166301626 19:41914674-41914696 GGAGAGACAGAGATGGTGGAAGG - Intronic
1166301633 19:41914701-41914723 GGAGAGACAGAGATGGTGGAAGG - Intronic
1166301640 19:41914728-41914750 GGAGAGACAGAGATGGTGGAAGG - Intronic
1166301677 19:41914855-41914877 GGAGAGACAGAGATGGTGGAGGG - Intronic
1166456278 19:42942675-42942697 GGCTATACAGAGATAGGAGCTGG - Intronic
1166627538 19:44372725-44372747 GGGTAGGTTGAGATGGGAGACGG + Intronic
1166832071 19:45645033-45645055 GGCTAGACGGAGAGGAGAGAAGG - Intronic
1166861051 19:45811403-45811425 GGGGTGCCAGGGATGGGAGAAGG + Intronic
1166965549 19:46527609-46527631 GTGTAGACAGAGATAGGAGAAGG - Intronic
1166979708 19:46625263-46625285 GTGGAGGCAGCGATGGGAGATGG - Intergenic
1167427516 19:49437046-49437068 GATTTGACAGAGCTGGGAGAGGG - Intronic
1167612334 19:50513540-50513562 AGGGAGACAGAGATGGGGGCAGG + Intronic
1167619013 19:50551141-50551163 GGGGAGAAAAGGATGGGAGATGG - Intronic
1167792287 19:51689810-51689832 GGGAGGACAGAGATGGGGGCTGG + Intergenic
1168348257 19:55661213-55661235 GGGTAGAGGGACAAGGGAGAGGG - Intronic
1168574471 19:57498707-57498729 GGGTAGAAAGAGTAGGGAGGTGG - Intronic
925130160 2:1488804-1488826 AGGAAGACAGGGATGGGGGAAGG - Intronic
925423566 2:3730615-3730637 GGGTAGAATGAGCAGGGAGAAGG + Intronic
926421942 2:12708409-12708431 GGGGAGAAAGAGAGAGGAGAGGG + Intergenic
926651888 2:15355696-15355718 AGGAAGAGAGAGATGGGGGAGGG - Intronic
926711902 2:15888676-15888698 TGGAAGCCAGAGATGTGAGAGGG + Intergenic
927154475 2:20213607-20213629 GGGCAGACAGGGCTGGGGGAGGG - Intronic
927324673 2:21790679-21790701 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
927803295 2:26121281-26121303 GGGTAGACAAAGGTGGGATTAGG - Intronic
928003412 2:27541403-27541425 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
929210300 2:39349618-39349640 GGAGAGACAGAGGAGGGAGAAGG + Intronic
929526181 2:42704993-42705015 AGGTAGCCTGGGATGGGAGAGGG + Intronic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
930994516 2:57700232-57700254 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
931465017 2:62478160-62478182 TTGTAGACAGAGTTGGGAAAAGG + Intergenic
931555099 2:63494577-63494599 GGGTAGGCAGAGTTGTGGGAGGG + Intronic
931584062 2:63808302-63808324 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
932133158 2:69205385-69205407 GGGTGGACAAAGACTGGAGAAGG - Intronic
932300442 2:70663353-70663375 GCAGGGACAGAGATGGGAGAAGG + Exonic
932664514 2:73686061-73686083 GGGGAGACAGAGAGAGGAGATGG - Intergenic
932702196 2:73999758-73999780 GGGCAGATAGAGATGGGAGGAGG + Intronic
932749644 2:74363257-74363279 GGGAGGACTGGGATGGGAGATGG - Intronic
933251870 2:80038273-80038295 AGGAAGATAGAAATGGGAGATGG + Intronic
933897945 2:86827643-86827665 GGGTAGACAAATATGGGGCAGGG + Intronic
934625593 2:95847723-95847745 GGGTAGACAGAAATGGAATGAGG + Intronic
934916637 2:98305617-98305639 GGGAAGCCCGAGATGGGAGCAGG - Intronic
935875292 2:107499560-107499582 AGCAAGGCAGAGATGGGAGATGG + Intergenic
935936450 2:108189638-108189660 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
936849497 2:116878407-116878429 GGGTGGACAGAGATAAGAGCTGG + Intergenic
937115098 2:119399312-119399334 GGATGGACAGAGATGGGGGCAGG - Intergenic
937257964 2:120568204-120568226 GGGCAGACAGAGAAGCCAGAGGG - Intergenic
937271688 2:120656908-120656930 GAGTAAGCAGAGAAGGGAGAGGG - Intergenic
937356874 2:121203223-121203245 GGGTAAAGAGAGAAGGCAGAAGG + Intergenic
937673527 2:124564256-124564278 GGGGAGACAGAGATAGGCTAGGG + Intronic
937972829 2:127563990-127564012 GGAGAAAGAGAGATGGGAGAGGG + Intronic
938545968 2:132331839-132331861 GGGTAGGTTGAGATGGGAGACGG - Intergenic
938714425 2:134006566-134006588 GTGAAGACAGAGTTAGGAGATGG - Intergenic
938720467 2:134063394-134063416 GGGGAGAGGGAGATGGGAGAGGG - Intergenic
938790468 2:134671423-134671445 GAGTGGCCAGACATGGGAGAGGG - Intronic
939187000 2:138872375-138872397 GGGGAGAGGGAGAGGGGAGAGGG + Intergenic
939188362 2:138886752-138886774 GGGCAGTCAGAAATGGAAGATGG + Intergenic
939427378 2:142056820-142056842 GGGAAGAAAGATATGGGAGAAGG - Intronic
939709722 2:145502134-145502156 GAAGAGACAGACATGGGAGATGG + Intergenic
939734777 2:145830135-145830157 AGGTCCACAGATATGGGAGAAGG + Intergenic
940277087 2:151950797-151950819 GAGTAGAAAGAGAAGGGAGTGGG + Intronic
940516434 2:154689861-154689883 TAGTAGATAGAGATGAGAGAAGG + Intergenic
942516935 2:176764165-176764187 GGGAAGAAAGGGATAGGAGAAGG + Intergenic
942716274 2:178896190-178896212 TGGTAGGCTGAGATGGGTGAAGG - Intronic
942863841 2:180648599-180648621 GGGATGACAGAGATGAGAAAAGG - Intergenic
942884649 2:180908678-180908700 GGGAAGACAAGGCTGGGAGAAGG + Intergenic
944060531 2:195567200-195567222 GGGGAGACGGAGACGGGAGACGG - Intergenic
944068602 2:195645580-195645602 GGGTAGAAAGAAATGGGGAATGG - Intronic
944686680 2:202123826-202123848 GGAGAGAGAGAGAAGGGAGAGGG - Intronic
944714015 2:202361101-202361123 GGGGAGAGGGAGAAGGGAGATGG - Intergenic
944745259 2:202649289-202649311 GGGAAGACAGAAAAGAGAGAGGG - Intronic
944820293 2:203423310-203423332 GGATACACAGAGATGAGTGATGG + Intronic
944961069 2:204874465-204874487 GGGATGACAGAGAAGAGAGAAGG + Intronic
945537489 2:211036407-211036429 GGGTAGAAAGAGAAGGGAGTAGG + Intergenic
946189745 2:218002076-218002098 GGGTAAAGGGGGATGGGAGAGGG - Intronic
946194071 2:218022794-218022816 GGGGTGGCAGAGATGGGGGATGG + Intergenic
946304901 2:218850910-218850932 GGGCAGACAGAGATGGTGGGAGG + Intergenic
947524630 2:230870641-230870663 GAGAAGACAGAGCAGGGAGAAGG - Intronic
947897859 2:233692206-233692228 GGGCACCCAGAGATGGCAGATGG + Intronic
948063838 2:235062020-235062042 AGGCAGACAGAGATGGAGGAGGG + Intergenic
948091772 2:235301695-235301717 GGGAGGAGAGAGGTGGGAGAAGG - Intergenic
948134671 2:235627844-235627866 GGCCAAACAGAGATGGGACAAGG + Intronic
948533837 2:238631689-238631711 GGGGAGGCAGAGATGGCAGTGGG - Intergenic
948552786 2:238785749-238785771 GGAAGGACATAGATGGGAGAAGG - Intergenic
948630563 2:239299920-239299942 GGGGAGACAGAGAAGGAAGAGGG + Intronic
948855245 2:240727300-240727322 GGGAACACAGGGAAGGGAGAGGG + Intronic
948858540 2:240741908-240741930 TGGTAGACAGAGGTGGGTGAAGG - Intronic
1169056587 20:2626959-2626981 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1169141571 20:3229926-3229948 GGGGTGTCAGAGATGGGACAGGG - Intronic
1170351650 20:15448002-15448024 GGGGAGGCAGAGATGGGATGGGG - Intronic
1170624166 20:18018809-18018831 AGGTAAACAGAGTTGGGAGGAGG + Intronic
1170650451 20:18235213-18235235 GAGTACAGAGAGATGGGAAATGG + Intergenic
1170724683 20:18915878-18915900 GTGTGGAGAGAGATGGGAGGAGG - Intergenic
1170796543 20:19552338-19552360 GTGTAGACAGCAATGTGAGAGGG - Intronic
1171067220 20:22029422-22029444 GGGTAGACTGAGAGGTGGGAGGG + Intergenic
1171433702 20:25103661-25103683 GGGCAGGCAGAGATGACAGATGG + Intergenic
1171874828 20:30564572-30564594 GGGTAGGTTGAGATGGGAGACGG - Intergenic
1172043324 20:32061563-32061585 GGCTAGACAGTGATGGGAGTTGG + Intronic
1172219132 20:33260604-33260626 GGGTAGACAGGAAGAGGAGATGG + Intergenic
1172489215 20:35321122-35321144 GAGTAGACAGACAAGAGAGACGG + Intronic
1172909733 20:38399087-38399109 GTGTAGACAGAGCTGGGCGTGGG + Intergenic
1173296101 20:41759530-41759552 GGAGAAACAGAGATGAGAGAAGG - Intergenic
1173799518 20:45886444-45886466 GGGCAGACAGGGTTGGGAGGAGG - Intergenic
1174365424 20:50053524-50053546 GGGAAGACAGAGATGTAAGGGGG + Intergenic
1174964717 20:55199436-55199458 GGGTAGACAGTCTGGGGAGATGG + Intergenic
1175081856 20:56427297-56427319 GGGAAGACAGAGAAGGAGGAAGG - Intronic
1175494666 20:59405286-59405308 GGATAGACAGTAATTGGAGAGGG + Intergenic
1175495236 20:59409906-59409928 GAATAGACAGAGATGGGGTAAGG + Intergenic
1175518914 20:59587299-59587321 GGTTGCACAGAGGTGGGAGAAGG + Intronic
1175688219 20:61046678-61046700 AGCTAGACAGAGCTGGTAGATGG - Intergenic
1175780460 20:61679191-61679213 GAGGAGACAGAGATGGAAGGTGG - Intronic
1175802686 20:61810166-61810188 ACGGAGACAGAGATGGGTGAGGG + Intronic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1176371095 21:6061729-6061751 GGAGGGAGAGAGATGGGAGAGGG + Intergenic
1176590491 21:8644813-8644835 GGGGAGAGAGAGGTGGGAAAGGG - Intergenic
1176659575 21:9621860-9621882 GGATAGAGAGAGAAGGGAGGAGG + Intergenic
1176719062 21:10378851-10378873 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1176719069 21:10378877-10378899 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1176723491 21:10412172-10412194 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1176808793 21:13516582-13516604 GGGTAGATGGAGGTGGGAAAGGG + Intergenic
1177410827 21:20728626-20728648 GGGAAGACAGAGATGGGTTTTGG + Intergenic
1177674382 21:24277334-24277356 GGGGAGAGAGGGAGGGGAGAGGG - Intergenic
1178146201 21:29743353-29743375 GGGTGGACAGACATGGGAGTGGG + Intronic
1178509719 21:33194180-33194202 GGGTTGACTGAGAAGGGAAATGG + Intergenic
1179112445 21:38459030-38459052 GGGCATAAAGAGATGGGGGATGG - Intronic
1179538473 21:42067987-42068009 AGGGAGAGAGAGATGGGGGAGGG + Intronic
1179548956 21:42131256-42131278 GGAAAGACAGAGAAGGGAGAGGG - Intronic
1179752424 21:43476812-43476834 GGAGGGAGAGAGATGGGAGAGGG - Intergenic
1180116144 21:45706481-45706503 CAGTAGAGAGAGATGGCAGAGGG - Intronic
1180261503 21:46672688-46672710 GGGGAGGCAGAGATGGGAGGAGG + Intergenic
1180273319 22:10621846-10621868 GGGGAGAGAGAGGTGGGAAAGGG - Intergenic
1180300276 22:11031698-11031720 GGGGAGAGAGAGACGGGAGAGGG - Intergenic
1180300298 22:11031847-11031869 GGGGAGAGAGAGACGGGAGAGGG - Intergenic
1180300305 22:11031871-11031893 GGAGAGAGAGAGACGGGAGAGGG - Intergenic
1180304648 22:11064944-11064966 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1180469277 22:15641243-15641265 GGGTAGATGGAGAAGGGAGAGGG - Intergenic
1180487497 22:15816420-15816442 GGGAACACAGAGCTAGGAGAAGG + Intergenic
1181312050 22:21950194-21950216 GGGTACACAGAAATGGAAGGAGG - Intronic
1181641444 22:24202098-24202120 GGGTAGAAAGAGCTGGGAGGAGG + Intergenic
1182050959 22:27312141-27312163 GGGGAGAGAGAGAGAGGAGACGG + Intergenic
1182078411 22:27511131-27511153 GTGTGCACAGATATGGGAGAGGG + Intergenic
1182243527 22:28936319-28936341 GAATAGGCAGAGATGAGAGATGG - Intronic
1182323757 22:29495908-29495930 GGCTACACAAAGATGAGAGAAGG + Intergenic
1182720743 22:32397069-32397091 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1182881167 22:33734762-33734784 GTTTAAACAGAGGTGGGAGAAGG - Intronic
1183160256 22:36108552-36108574 GGGTAGGCAGGGAGGGGAGGAGG + Intergenic
1183354552 22:37351186-37351208 GGAGAGGAAGAGATGGGAGAAGG - Intergenic
1183429830 22:37758890-37758912 GGCTAGACAGGGATAGGAAAAGG - Intronic
1184164075 22:42717165-42717187 GGGAAGACAAAGGTGGCAGATGG + Intronic
1184257809 22:43296980-43297002 GGGAGGTCAGAGGTGGGAGAAGG + Intronic
1184521269 22:44995743-44995765 GTGGAGACAGAGATGAGGGAGGG + Intronic
1184925453 22:47633268-47633290 GGGGAGCCAGAGGTGGCAGAAGG + Intergenic
1185004865 22:48269983-48270005 GGGAAAGGAGAGATGGGAGAGGG + Intergenic
949243235 3:1895343-1895365 GGGCAGATGGAGAGGGGAGAGGG + Intergenic
950096116 3:10331678-10331700 GGGTAGGCAGGGAGGGGAGATGG - Intronic
950098247 3:10342547-10342569 GGTTAGCCAGAGCTGGGACAGGG + Intronic
950678435 3:14568700-14568722 AGGGAGACAGAGATGGGATGGGG + Intergenic
951076589 3:18401017-18401039 TGTTAGCTAGAGATGGGAGAGGG - Intronic
951455464 3:22887147-22887169 GGGTAAGCAGTGTTGGGAGATGG + Intergenic
951674512 3:25221679-25221701 GGTTAAAAAGAGATGGGAGAGGG - Intronic
951870352 3:27355239-27355261 GGGCAGATAGAGAAGGGAGGAGG - Intronic
952298948 3:32086880-32086902 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
952299248 3:32089356-32089378 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
952405240 3:32999347-32999369 GGGAAGACAGAGAAGTGGGAGGG + Intronic
952820938 3:37485078-37485100 GGGAAAACAGAGAGGGGACAGGG + Intronic
952894523 3:38068969-38068991 GGTGAGTCAGATATGGGAGAGGG + Intronic
953044355 3:39281573-39281595 GGAAAGACAGAGAACGGAGAAGG - Intronic
953385701 3:42504595-42504617 GGGTCCACAGAGAGAGGAGAAGG + Intronic
953487689 3:43317706-43317728 GGCTAGGCAGAGGAGGGAGATGG - Intronic
954954441 3:54507149-54507171 GGGTGGACAGAGGTGGAAAATGG - Intronic
954956096 3:54519312-54519334 GGGTTCACAGAGATGTGAGTAGG + Intronic
955718936 3:61861681-61861703 AATTAGTCAGAGATGGGAGAAGG + Intronic
955963926 3:64368722-64368744 GGGGTGAATGAGATGGGAGAAGG + Intronic
956289732 3:67648815-67648837 GGGTGCACAGAGAAGGGAGAGGG - Intronic
956439614 3:69267093-69267115 GGATAGAAAGAGATAGGACAGGG + Intronic
957111399 3:75963804-75963826 GTGAAGACAGAGCTGTGAGAAGG - Intronic
957995898 3:87689806-87689828 GGGTAGACAGAATTGGGGGTTGG - Intergenic
959572597 3:107900702-107900724 GGGAGGACAGTGCTGGGAGAAGG + Intergenic
959584474 3:108013382-108013404 AGACAGACAGAGAAGGGAGAAGG + Intergenic
959889968 3:111543777-111543799 AGCTAGACAGAGATGGGGTAAGG - Intronic
960570166 3:119178003-119178025 CGATAGGCAGAAATGGGAGAAGG + Intronic
960591364 3:119368944-119368966 GGGTGGGTAGAGAGGGGAGAGGG + Intronic
960702602 3:120451717-120451739 GGGATGACAGGGATGGGAGGAGG - Intergenic
960862965 3:122169961-122169983 GGGTAGAAAGAGTAGGGAGGAGG + Intergenic
961012404 3:123445231-123445253 GGGTGGGGAGAGAAGGGAGAGGG + Intronic
961079853 3:124016978-124017000 GGGTGGGCAGAGCTGGGACATGG - Intergenic
962571990 3:136722658-136722680 GGGGAGAGGGAGAGGGGAGAAGG - Intronic
962814793 3:138988195-138988217 GGGTAGAGAGGCATGGGAAAGGG - Intergenic
962849812 3:139299846-139299868 GGCCAGACAGAGATGGGGCAAGG + Intronic
962913069 3:139872794-139872816 GGGTAGAAAGAGATTTTAGAGGG + Intergenic
963256070 3:143146062-143146084 GGGGAGAGAGAGATGTCAGACGG - Intergenic
964202076 3:154128837-154128859 GGGTAGAAAGCGCTGGGAGGAGG - Intronic
964417308 3:156460988-156461010 GGGGAGAGGGAGAAGGGAGAAGG - Intronic
964608389 3:158583592-158583614 TGAGAGACAGAGATGGGAAATGG + Intronic
964698172 3:159533607-159533629 GGGCAGACAGAGCAGTGAGATGG - Intronic
966826130 3:183966599-183966621 GGAGAGACAGAGATGGGGGGAGG - Intronic
966941951 3:184753355-184753377 GAGAAGAAAGTGATGGGAGAAGG + Intergenic
966942075 3:184753844-184753866 GAGAAGAAAGTGATGGGAGAAGG + Intergenic
966942137 3:184754080-184754102 GAGAAGAAAGTGATGGGAGAAGG + Intergenic
967129788 3:186459846-186459868 GGGAAGGTAGAGGTGGGAGAAGG + Intergenic
967194294 3:187013276-187013298 GGGAAGTAATAGATGGGAGAAGG - Intronic
967725966 3:192862727-192862749 GGACATACACAGATGGGAGATGG + Intronic
968139277 3:196243515-196243537 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
968478247 4:822712-822734 AGCAAGACAGAGATGGGAAATGG - Intronic
969182409 4:5452239-5452261 GGGTAGACAGAGAAGGTTGAGGG + Intronic
969568753 4:7995781-7995803 GGGAAGACAGACATGTGAGAGGG + Intronic
969820873 4:9719336-9719358 GGGTAGAAAAGGCTGGGAGAGGG + Intergenic
970015278 4:11505978-11506000 GAGGAGTCTGAGATGGGAGATGG - Intergenic
970522095 4:16895627-16895649 AGGAAGAGAGAGATGGAAGAGGG + Intronic
970842975 4:20497789-20497811 GGGAAGACAGTGTTGGGAGCAGG + Intronic
971150051 4:24022042-24022064 GGGAAGACAGTGGTGTGAGAAGG + Intergenic
971188668 4:24405865-24405887 AGGAAGACAGAAATGGAAGAAGG - Intergenic
971626206 4:28923250-28923272 AGGGAGAAAGAGAGGGGAGATGG - Intergenic
973263191 4:48185822-48185844 AGGGAGAGGGAGATGGGAGAGGG - Intronic
973281684 4:48364854-48364876 GGGGAGACGGAGACGGGAGAGGG + Intronic
973663262 4:53130575-53130597 GTGTAGAGGGAGAGGGGAGATGG - Intronic
973892286 4:55379098-55379120 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
975164304 4:71160604-71160626 GGGTATTATGAGATGGGAGATGG + Intergenic
975408244 4:74016994-74017016 TGGTATACAGAGAAAGGAGATGG - Intergenic
976808620 4:89075818-89075840 GGGTAGATAGGGCTGGAAGAAGG - Intronic
977578241 4:98697518-98697540 GGGTAGCAAGAGCAGGGAGAAGG - Intergenic
977726138 4:100299168-100299190 GGACAGAGAGAGATGGGAAATGG + Intergenic
978819380 4:112948106-112948128 GAGTAGGGAAAGATGGGAGATGG + Intronic
979279123 4:118844908-118844930 GGGCAGAGAGAGGTGGGTGAGGG + Intergenic
979406812 4:120322712-120322734 GGAGAGATAGAGATGGAAGAGGG - Intergenic
979533688 4:121795765-121795787 GGGTAGAAAGAGCAGGGAGAAGG + Intergenic
980869639 4:138595738-138595760 GGATAGAGAGAGATGGGGGAGGG + Intergenic
980889382 4:138797729-138797751 AGGGAAACAGAGTTGGGAGAGGG + Intergenic
982134392 4:152259444-152259466 GAGTAGACAGAGGAAGGAGAGGG - Intergenic
982197257 4:152928831-152928853 GGTTGGATAGAGAGGGGAGAGGG - Intergenic
982485469 4:155959871-155959893 GCATAGCCAGAGATGGCAGAAGG + Intergenic
982605547 4:157512431-157512453 GAGTTCACAGAAATGGGAGATGG - Intergenic
983507735 4:168573274-168573296 GGGTAGAAAGAAATGGGGTAGGG - Intronic
985030819 4:185787651-185787673 GGGTGGAGACAGATGGGAGGAGG - Intronic
985183176 4:187287457-187287479 AGGGAGACAGAGATGGGGGTGGG + Intergenic
985296791 4:188444725-188444747 GGGCACAGAGAGATGGGACAAGG + Intergenic
985415797 4:189734553-189734575 GGATAGATAGAGAAGGGAGAAGG - Intergenic
985683377 5:1268641-1268663 GGGAAGACACAGGTGAGAGACGG + Intronic
986085753 5:4444055-4444077 GGGGAGTCAGGGAGGGGAGAGGG - Intergenic
986994695 5:13593622-13593644 GAGTAGAAAGGGATGGGAGATGG - Intergenic
987257258 5:16168751-16168773 AGGAAGAAAGAGATGGAAGAAGG + Intronic
987917041 5:24228176-24228198 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
988672689 5:33398939-33398961 TGGGAGACAGAGAAGTGAGAAGG + Intergenic
989576002 5:42989260-42989282 GGCTAGACAGGAATGGGATAGGG + Intergenic
989992463 5:50783192-50783214 GGGGAGACAGGGAAGGGAGATGG + Intronic
990041947 5:51387274-51387296 GGGAAAAGAGAGATGGGGGAAGG + Intronic
990757621 5:59092857-59092879 GAGTAGAAAAAGACGGGAGAAGG - Intronic
991454878 5:66792271-66792293 GGGTAGACAGAGAGGCCAGGAGG - Intronic
991460139 5:66849424-66849446 GGGTAAAGAGAGAGGGGAAAGGG - Intronic
991982129 5:72243103-72243125 GGGTAGACAGAGATGGGAGAGGG + Intronic
992125648 5:73637294-73637316 AGGTAGAGAAAGATGGGAGCGGG - Intronic
992132716 5:73709558-73709580 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
992833174 5:80615246-80615268 GGGTAGAGAGAGAGCAGAGAAGG - Intergenic
994205286 5:97027914-97027936 AGGAAGACAGAGATAAGAGAAGG - Intronic
994296320 5:98092791-98092813 GGGAGCACAGAGATGGGAGAGGG + Intergenic
994907343 5:105858900-105858922 GGGGAGATGGAGACGGGAGAAGG - Intergenic
995063422 5:107835708-107835730 GGGTGGAAAGAGAGGGGAGAAGG + Intergenic
995328380 5:110918228-110918250 GGGTACAGAGAGAAGGGACAAGG + Intergenic
996159725 5:120147403-120147425 GGGGAGACGGAGACGGGAGACGG - Intergenic
996602432 5:125280018-125280040 GAGTAGAGAGAGATGAGAGGAGG + Intergenic
998067259 5:139169825-139169847 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
998519376 5:142785919-142785941 GGCAAGAGAGAGATGGTAGAAGG - Intronic
998562207 5:143182118-143182140 TGGTAGACAGTGATGGGTGTGGG - Intronic
998938933 5:147260263-147260285 AGAGAGACAGAGAGGGGAGAGGG - Intronic
999256131 5:150210833-150210855 GGGTAGACGCAGAGGGCAGAGGG + Exonic
999710284 5:154312345-154312367 GGGGGGATAGAGAGGGGAGAGGG - Intronic
1000122675 5:158212202-158212224 GGGCAGAGAGAGATGGGGAAAGG + Intergenic
1000204670 5:159047510-159047532 TGGCTGACAGAGATGGGGGAGGG + Intronic
1000346756 5:160320951-160320973 GGAGAGACAGAGAGGAGAGAAGG - Intronic
1001127347 5:169031671-169031693 GAGTAGTAGGAGATGGGAGACGG + Intronic
1001160071 5:169304873-169304895 GGGTAGACAGACAGGAGAGCAGG - Intergenic
1001269554 5:170301183-170301205 AGGGAGACAGACATGGGCGAGGG - Intergenic
1001277870 5:170363858-170363880 GGGTAGACAGAAATGGGGAAGGG - Intronic
1001295629 5:170496867-170496889 GGGTAGAAAGGGATGGGAGCTGG - Intronic
1002148397 5:177205688-177205710 GTGGTGACAGTGATGGGAGAAGG - Intronic
1003016033 6:2468215-2468237 GGGTAGACAGAGAGAGGAAGGGG + Intergenic
1003381514 6:5628684-5628706 TGGTGAACAGAGATGAGAGATGG + Intronic
1003758968 6:9153217-9153239 GTGAAGAGAGAAATGGGAGATGG + Intergenic
1004664437 6:17736507-17736529 GGGGAGAGGGAGAGGGGAGAGGG + Intergenic
1004916044 6:20332943-20332965 GGGTACACTGAGCTTGGAGAAGG + Intergenic
1005622552 6:27633408-27633430 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1006445068 6:34075424-34075446 GGGCAGATAGAGACGTGAGAAGG - Intronic
1006898643 6:37486158-37486180 GTGAAGTCAGAGATGGGAAATGG - Intronic
1006935587 6:37715446-37715468 GGGAAGAAAGAGAAGGGACAGGG - Intergenic
1007445571 6:41903011-41903033 GGGTAGCTACAGATGGGAAAAGG + Intergenic
1007448164 6:41922942-41922964 GGAGAGACAGAGAGAGGAGATGG - Intronic
1007708680 6:43807078-43807100 GGTGAGACAGAGATGGAAGATGG - Intergenic
1007836575 6:44678591-44678613 GAGGAGACAGAGAGGGGATAAGG - Intergenic
1008054293 6:46930510-46930532 GGGTAGAAAGAAGTGGGAAATGG + Intronic
1008624938 6:53306231-53306253 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1008624946 6:53306251-53306273 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1008624969 6:53306306-53306328 GGGGAGAGGGAGAGGGGAGAGGG + Intronic
1008624986 6:53306353-53306375 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1008624994 6:53306379-53306401 GGGGAGAGAGAGAGGGGAGAGGG + Intronic
1010123285 6:72404898-72404920 GGGGAGAGAGAGCAGGGAGAGGG - Intergenic
1010184156 6:73123472-73123494 GGGCAGAGAGAAATGGGAGGAGG + Intronic
1010613332 6:77983587-77983609 GGGTAAAAACAGATGGGAAAGGG - Intergenic
1010956432 6:82095693-82095715 TGGTAGAGAGAGCTGGAAGATGG + Intergenic
1012179193 6:96129337-96129359 CGGGAGGCAGAGGTGGGAGAAGG + Intronic
1012881205 6:104792859-104792881 GGGTAGAAAGAGCAGGGAGGAGG - Intronic
1013057722 6:106600568-106600590 GGGTAGATGGAGAAGGGAGTGGG - Intronic
1013384745 6:109615196-109615218 GGGCAGACAGTGATTGGAGTAGG - Intronic
1013825797 6:114209759-114209781 GGGAAAAAAGAAATGGGAGAAGG + Intronic
1014813786 6:125912897-125912919 GGGTAGACAGGGATGTAAGAAGG + Intronic
1015218547 6:130778040-130778062 GAATAGAGAGAGGTGGGAGAAGG + Intergenic
1015424954 6:133054893-133054915 GGGTCCACAGAAATGGAAGATGG + Intergenic
1015510044 6:134029504-134029526 TGATAGACAGATATGGAAGAAGG - Exonic
1016317694 6:142808459-142808481 GGGAAGAGAGAGATGTGGGAGGG + Intronic
1016317719 6:142808555-142808577 TGGAAGAGAGAGATGGGGGAGGG + Intronic
1016381985 6:143493661-143493683 GACTAGGCAGAGATTGGAGAGGG - Intergenic
1016601530 6:145866906-145866928 AGGTAGACAGAGAGGGGACAGGG + Intronic
1016764610 6:147778244-147778266 GGATAGAAATAGATGGGAAAGGG - Intergenic
1017654232 6:156612171-156612193 GGTTAGACAGAGGTGAGTGAAGG + Intergenic
1018300072 6:162392377-162392399 TAGTAGACAGAGATTGGAGATGG - Intronic
1018453834 6:163934452-163934474 GGGTATACAGAGATACAAGAAGG + Intergenic
1018528772 6:164741569-164741591 GGGTGTTCAGAGCTGGGAGAGGG - Intergenic
1018807962 6:167275958-167275980 GGGTAGGGAGAGATGTGTGATGG - Intronic
1018846004 6:167556491-167556513 GAGAAGACAGAGATGGGAATTGG - Intergenic
1018914041 6:168121852-168121874 GGGTAGGTAGAAAAGGGAGAGGG + Intergenic
1019103349 6:169649824-169649846 GGATGGAGAGAGATGAGAGATGG - Intronic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019779290 7:2930098-2930120 GGAGAGACAGAGAAAGGAGAAGG + Intronic
1019825238 7:3279195-3279217 GGGAAGAGAGAGGGGGGAGAGGG + Intergenic
1019964148 7:4485019-4485041 GGGCAGAGAGAGAAGAGAGAGGG + Intergenic
1020032160 7:4940709-4940731 GGGCAGACAGTGATGGGAACAGG + Intronic
1020185203 7:5953727-5953749 GGGGAGAGAGAGAGGGGAGGGGG - Intronic
1020297712 7:6771017-6771039 GGGGAGAGAGAGAGGGGAGGGGG + Intronic
1020426715 7:8074940-8074962 GGATAGACATGGAGGGGAGAGGG + Intronic
1020934226 7:14440126-14440148 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1021012244 7:15484740-15484762 GGGAAGATAGAGATGGCAGGGGG + Intronic
1021576868 7:22112992-22113014 AGGTAGAGAGAGGTGGGTGAGGG + Intergenic
1022243776 7:28537489-28537511 AGGTGTACAAAGATGGGAGATGG + Intronic
1022674831 7:32489664-32489686 GGATAGACAGAGTTGGGAAAGGG - Intronic
1023044005 7:36196384-36196406 AGGGAGAGGGAGATGGGAGAGGG - Intronic
1023044013 7:36196409-36196431 AGGGAGAGGGAGATGGGAGAGGG - Intronic
1023316921 7:38947608-38947630 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1023478060 7:40602419-40602441 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1024273526 7:47659784-47659806 GGGTAGACAGGGACGGGGTAAGG - Exonic
1025087103 7:56032307-56032329 GGGTACAAAGACAAGGGAGAGGG + Intronic
1026287184 7:68973619-68973641 GGGCAGACACAGTTGGGAAAGGG - Intergenic
1026340806 7:69432358-69432380 GGGTAGAAAGAGCAGGGAGCAGG + Intergenic
1026402258 7:70026362-70026384 GGGCAGACAGAGGTGAGAGCAGG + Intronic
1026893755 7:73998401-73998423 GGGCAGCCAGAGGTGGGAGTGGG + Intergenic
1026906273 7:74064690-74064712 GGGTTGAAAGAGAGAGGAGAGGG - Intronic
1027294746 7:76757541-76757563 GGACAGACAGAGATTGGAGTTGG + Intergenic
1028303716 7:89234667-89234689 GGGGAGAGAGAAATGGGAGTGGG - Intronic
1028567915 7:92253317-92253339 GGGTAGATGAAGGTGGGAGATGG - Intronic
1029355197 7:100046609-100046631 GGGAAGAAAGAGATGGGAAATGG - Intergenic
1029439196 7:100577921-100577943 GCAGAGGCAGAGATGGGAGATGG + Intronic
1029635040 7:101777942-101777964 GGGCACACAGCGATGGGAGCAGG + Intergenic
1030854932 7:114543819-114543841 GGGTGAACATAGATGAGAGATGG - Intronic
1031161861 7:118178389-118178411 GGGTAGACACTGATGAGTGATGG - Intergenic
1031264304 7:119564963-119564985 GGGCAGACAGGGAGGGAAGAGGG + Intergenic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1031414497 7:121479387-121479409 GGGTGGAGAGAGAGGGGAGAGGG + Intergenic
1032343467 7:131097571-131097593 GAGCATAAAGAGATGGGAGAAGG + Intergenic
1032880499 7:136084804-136084826 GGTTTCACAGAGCTGGGAGATGG + Intergenic
1033229297 7:139584080-139584102 GAGAAGTCAGAGGTGGGAGAAGG + Intronic
1033433860 7:141314512-141314534 GGCCAGAAAGAGATGGGAGGAGG - Intronic
1033437614 7:141347720-141347742 GAGGAGACAGAGAAGGCAGACGG - Intronic
1033527681 7:142232595-142232617 GGGGAGCCAGAGAGGGGGGATGG + Intergenic
1034310101 7:150079766-150079788 GGGAAGGCAGAGCTGGGAAAAGG - Intergenic
1034392204 7:150795403-150795425 GTATAGACAGAGGTGGAAGATGG - Intronic
1034701512 7:153100084-153100106 AGGTAGAGAGAAATGAGAGAGGG - Intergenic
1034796745 7:154020855-154020877 GGGAAGGCAGAGCTGGGAAAAGG + Intronic
1034922780 7:155097401-155097423 GGAGAGAGAGAGAAGGGAGAGGG + Intergenic
1034970664 7:155417443-155417465 GGGAAGAGAGAGATGGGAGCAGG - Intergenic
1035343144 7:158177536-158177558 CTGTGGACAGGGATGGGAGAGGG - Intronic
1035914664 8:3606177-3606199 GGGAGGACAGAGATGGGCCAAGG + Intronic
1037113521 8:15195464-15195486 GGTTAGAGAGAGCTGAGAGATGG - Intronic
1037438490 8:18889628-18889650 TGGGAGCCGGAGATGGGAGATGG - Intronic
1037542453 8:19885559-19885581 GGGAAGAGGGAGAAGGGAGAAGG - Intergenic
1037640294 8:20736162-20736184 GAGGAGACAGAGATATGAGATGG + Intergenic
1037734001 8:21552482-21552504 GGGTGGAGAGAGATGGAAGGAGG - Intergenic
1037764213 8:21762005-21762027 AGGTAGCCAGAGAGGTGAGATGG - Intronic
1037804325 8:22050637-22050659 GGAGGGACAGAGAAGGGAGAGGG + Intronic
1038234792 8:25742173-25742195 GGGTGGATAGAGAAGCGAGAAGG + Intergenic
1038409062 8:27344166-27344188 GGGGAGAGAGAAGTGGGAGAGGG - Intronic
1038418630 8:27417448-27417470 GGGTGGACTGAGAAGGGATATGG + Intronic
1038468217 8:27786315-27786337 GGGTAGAAAGAGCAGGGAGGAGG + Intronic
1038814598 8:30888479-30888501 GGGGAGAGAGAGAAAGGAGAGGG - Intronic
1038848596 8:31252698-31252720 GGTGAGACAGAGGTGGAAGAGGG + Intergenic
1039148444 8:34476877-34476899 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1039859453 8:41444487-41444509 TGGTAGACAAAGGTGAGAGAGGG + Intergenic
1040579544 8:48686263-48686285 GGGTTGACACAGAAGGTAGAGGG - Intergenic
1041106685 8:54451731-54451753 GGATAGACAGAGATGGAGTAAGG - Intergenic
1042386626 8:68183214-68183236 GGGTATACAGAGAAAGGACATGG + Intronic
1043501384 8:80860930-80860952 GAGTAGACAGAAATGAGAGATGG + Intronic
1044056197 8:87572047-87572069 CGGTAGGCAGATATAGGAGATGG - Intronic
1044604663 8:94038259-94038281 AGGTAGTCAGAGATGAGATAGGG - Intergenic
1044816133 8:96115308-96115330 GAGTAGAGAGAGAAGGGAGGGGG - Intergenic
1044826165 8:96199330-96199352 GGGTAGGCAGAGAGGGGAGCAGG - Intergenic
1045900467 8:107273252-107273274 GGGTAGATAGAGAGAGGAGAGGG + Intronic
1047263725 8:123285866-123285888 GGCTAGACATAGATGGGAGTTGG - Intergenic
1047646348 8:126874412-126874434 GTGTTGAGAGAGGTGGGAGAAGG + Intergenic
1048075142 8:131061831-131061853 GGGAAGACAGAGAAGGAAGAAGG - Intergenic
1048155421 8:131943708-131943730 GGGTTGTCATAGATGGGTGAAGG - Intronic
1048379223 8:133849570-133849592 AGGATGACAGAGATGGGAGAAGG + Intergenic
1049160139 8:141092139-141092161 GTGTAGATACAGATGGGATAAGG + Intergenic
1049501689 8:142970845-142970867 GGGTTGCCAGAGAGGGCAGAGGG + Intergenic
1049501714 8:142970917-142970939 GGGTTGCCAGAGAGGGCAGAGGG + Intergenic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050665569 9:7932557-7932579 GGATAGACAGACATAGTAGATGG - Intergenic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051156474 9:14152849-14152871 GGGTTGTCAGAGGTGGGGGAGGG + Intronic
1052679362 9:31669228-31669250 GATTAGATAGAGATAGGAGAAGG + Intergenic
1052698410 9:31908589-31908611 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1052961814 9:34304508-34304530 AGGTAGACAGTGATTGGATAGGG + Intronic
1053289321 9:36869603-36869625 GGGAACACAGAGAAGGGGGATGG - Intronic
1053462732 9:38282985-38283007 GGAGAGAGAGGGATGGGAGAGGG + Intergenic
1053578896 9:39382418-39382440 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1053675150 9:40417980-40418002 GGATAGACAGAGAGGTAAGAAGG - Intergenic
1053843411 9:42210493-42210515 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1053885642 9:42643675-42643697 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1053924937 9:43044321-43044343 GGATAGACAGAGAGGTAAGAAGG - Intergenic
1054100479 9:60941222-60941244 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1054121876 9:61216847-61216869 TGGTAGACAGTGAGGGGAGGGGG + Intergenic
1054224661 9:62451124-62451146 GGGTAGATGGAGAAGGGAAAGGG - Intergenic
1054288427 9:63256512-63256534 GGATAGACAGAGAGGTAAGAAGG - Intergenic
1054386249 9:64558048-64558070 GGATAGACAGAGAGGTAAGAAGG - Intergenic
1054509471 9:65958313-65958335 GGATAGACAGAGAGGTAAGAAGG + Intergenic
1054585868 9:66965664-66965686 TGGTAGACAGTGAGGGGAGGGGG - Intergenic
1054921135 9:70543479-70543501 GGGTAGTCGGGGATTGGAGAGGG - Intronic
1054969881 9:71072920-71072942 GGGTAGAAAGAGTAGGGAGGAGG - Intronic
1055549910 9:77423831-77423853 GTGGGGACAGAGATGGGTGATGG - Exonic
1056897405 9:90563855-90563877 GGTTACACAGAGGTGGGAGCAGG - Intergenic
1057180049 9:93024876-93024898 GGGAAGACACAGCTTGGAGATGG + Intronic
1058304987 9:103428890-103428912 GGGTAGAAAGAGCAGGGAGCAGG + Intergenic
1058368463 9:104236052-104236074 CGGTAGAAAGAAAGGGGAGAGGG + Intergenic
1058605054 9:106712210-106712232 GGGTAGCGTGAGATGTGAGATGG - Intergenic
1058676069 9:107401166-107401188 GGGTACGCAGAGAGGAGAGAAGG - Intergenic
1059061682 9:111039430-111039452 GGGAAGCCAGAAGTGGGAGATGG - Intergenic
1059085206 9:111294059-111294081 GGGTACAAAGAAATGGCAGAAGG - Intergenic
1059132855 9:111772825-111772847 GGAGAGACAAAGAGGGGAGAAGG - Intronic
1059368900 9:113808976-113808998 GGGTGGACAGGGGTGGGAAATGG + Intergenic
1059457708 9:114410161-114410183 GGATAGACAGGGATGGGGGTGGG - Intronic
1059578088 9:115513426-115513448 GGGTAGAAGGAGATGTGAGCTGG - Intergenic
1059783799 9:117558481-117558503 GGATAGACAAAGCTGGGAGATGG + Intergenic
1059803503 9:117774044-117774066 AGGAAGAAAGAGAGGGGAGAAGG - Intergenic
1060042179 9:120309116-120309138 GGGTAGAAAGAGACTGGAAAGGG + Intergenic
1060495487 9:124115285-124115307 GTGTAGGGTGAGATGGGAGAGGG + Intergenic
1060669575 9:125457955-125457977 TGGAAGACAGAGATAAGAGATGG - Intronic
1060686876 9:125622815-125622837 GGGGAGACGGAGAGGGGAGAGGG - Intronic
1060935276 9:127511013-127511035 GGGAAGAGAGAGTTGGGAGAGGG - Intronic
1060950589 9:127599678-127599700 GGGGCGACAGAGAGAGGAGAGGG - Intergenic
1061071990 9:128316546-128316568 GGGGAGACAGAACAGGGAGAGGG + Intronic
1062134944 9:134921353-134921375 GGGTAGACCCAAATGTGAGAGGG + Intergenic
1062158930 9:135069246-135069268 GGGGAGACAGAGCAGGGAGGGGG + Intergenic
1062190461 9:135245382-135245404 GGGCAGACTGAGCTGGGACAAGG - Intergenic
1062605898 9:137348754-137348776 GGTTAGATAGAGAGGGGAGGGGG + Intronic
1203637136 Un_KI270750v1:123703-123725 GGATAGAGAGAGAAGGGAGGAGG + Intergenic
1185582267 X:1219114-1219136 GGGTAGATAGAGATTGATGACGG + Intergenic
1185623746 X:1468766-1468788 GGGGAGAGGGAGAGGGGAGAGGG - Intronic
1185708506 X:2282839-2282861 AGGGAGAGAGAGAAGGGAGAAGG + Intronic
1185916210 X:4038251-4038273 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1186045499 X:5532491-5532513 GGAGAGACAGAGATGGAAGGAGG + Intergenic
1186212534 X:7264538-7264560 AGGTAGACAAAGAAGGGAAAAGG + Intronic
1186442880 X:9601193-9601215 ATGTGGACAGAGATGGGAGCTGG - Intronic
1186473114 X:9836520-9836542 AGGGAGAGAGAGAAGGGAGAAGG - Intronic
1186820190 X:13280101-13280123 GGGAAGCCAGAGATAGAAGATGG + Intergenic
1187038389 X:15566475-15566497 GGATAGAGAGACATGGGGGAGGG + Intronic
1187270280 X:17774493-17774515 GGGCAGTAAGAGATGGGAGAAGG - Intergenic
1187306833 X:18102771-18102793 GGGAAGACACAGATGAGAGTAGG - Intergenic
1187373011 X:18725949-18725971 AGCTAGGCAGAGATGGGAGGGGG + Intronic
1187479923 X:19645985-19646007 GGCTAGACAGAGATGCAATAGGG - Intronic
1187695978 X:21920893-21920915 GGGTAGAGAGAGATGATAGGTGG - Intergenic
1187976047 X:24706420-24706442 TGGTATCCAGATATGGGAGATGG + Intronic
1188308403 X:28586729-28586751 GGGGAGACAGTGATGGGGGTGGG + Intergenic
1189075953 X:37914579-37914601 GGGGAGACAGAGATGGGATAAGG + Intronic
1189279201 X:39809340-39809362 GGGCGCACAGAGATGGGGGAGGG - Intergenic
1189753064 X:44242670-44242692 GTGTTGACTGAGATAGGAGAGGG - Intronic
1190054790 X:47175247-47175269 GGGTAGCGAGAGATGGGAAGAGG - Intronic
1190232319 X:48591744-48591766 GGGTGCACAGAGCTAGGAGAAGG + Intronic
1190322950 X:49189011-49189033 GGGTAAACAGAGAGGGGCCAAGG + Exonic
1190455117 X:50619441-50619463 GGATACACAGGGAGGGGAGAAGG + Intronic
1190688819 X:52897093-52897115 GGGTGGACTGCGAGGGGAGAAGG - Intronic
1190697164 X:52958699-52958721 GGGTGGACTGCGAGGGGAGAAGG + Intronic
1190714884 X:53094612-53094634 ACAGAGACAGAGATGGGAGAGGG - Intergenic
1190746516 X:53326301-53326323 GTGTAGCAAGGGATGGGAGATGG + Intergenic
1192084653 X:68084332-68084354 GGGGAGGGAGAGAGGGGAGAGGG + Intronic
1192153648 X:68727182-68727204 GAGTAGGCAGAGATGAGGGATGG - Intergenic
1192324667 X:70122446-70122468 AGGGAGACAGAGACGGGAGGGGG - Intergenic
1193334445 X:80272412-80272434 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1193404058 X:81080965-81080987 GGGTAGAAAGAGCAGGGAGGAGG + Intergenic
1194402467 X:93455849-93455871 GGGTAGAAAGAGCAGGGAGGAGG - Intergenic
1194473327 X:94325625-94325647 GGAGTGAGAGAGATGGGAGAAGG + Intergenic
1195431174 X:104791209-104791231 GGGTGGAGAGAGGAGGGAGAGGG - Intronic
1195477720 X:105305487-105305509 GGGGAGACAGAGAAAGGAGTGGG - Intronic
1195720864 X:107866783-107866805 GGGGAGAGGGAGATGGAAGAAGG + Intronic
1195892773 X:109713464-109713486 GGGAAGTGAGAGATGGGACAGGG + Intronic
1196788925 X:119446934-119446956 GGGAAGAGAAAGATTGGAGATGG - Intronic
1197181723 X:123543973-123543995 GGCTAGGCAGAGGTGGGTGAAGG - Intergenic
1197199131 X:123733511-123733533 GGGGAGAGGGAGACGGGAGAGGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1198766737 X:140087970-140087992 GGGAAGACAGAGGTGGGTGTTGG - Intergenic
1199435149 X:147804646-147804668 AGGTAGAAAGAGATAGTAGAAGG + Intergenic
1199664315 X:150084341-150084363 GGGAGGTCAGAGATGGGATAAGG - Intergenic
1199982135 X:152926996-152927018 GGGCAGACACAGAGGGAAGACGG - Intronic
1201625689 Y:16012164-16012186 GGGAAGAAAGAAAGGGGAGAAGG + Intergenic