ID: 991982430

View in Genome Browser
Species Human (GRCh38)
Location 5:72246639-72246661
Sequence ATCTTTAATTTAGTGCTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991982428_991982430 29 Left 991982428 5:72246587-72246609 CCAAGTAAACTGGGGATAAGGGA 0: 1
1: 0
2: 1
3: 5
4: 153
Right 991982430 5:72246639-72246661 ATCTTTAATTTAGTGCTGGTAGG 0: 1
1: 0
2: 0
3: 39
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991982430 Original CRISPR ATCTTTAATTTAGTGCTGGT AGG Intronic
904985350 1:34543195-34543217 AACTCTCATTTATTGCTGGTGGG + Intergenic
905002490 1:34683962-34683984 ATCTTTGATCAAGAGCTGGTAGG - Intergenic
906254620 1:44338629-44338651 ATCTTTGATTCAGTGCAGGAGGG + Intronic
907040739 1:51256996-51257018 AACTCTCATTTACTGCTGGTGGG - Intronic
908180539 1:61600391-61600413 TTTCATAATTTAGTGCTGGTAGG - Intergenic
908476966 1:64498452-64498474 ATCTTTACTTTTGTGCAGGGAGG + Intronic
909313476 1:74185256-74185278 ATCTCTCATTCATTGCTGGTGGG - Intronic
909486156 1:76176565-76176587 ATCTATAAGCTAATGCTGGTGGG - Intronic
909710004 1:78638046-78638068 ATCTCTCATGTATTGCTGGTGGG - Intronic
910882047 1:91930438-91930460 GTCTTTTATTTGGTGGTGGTGGG + Intergenic
911679478 1:100698427-100698449 ATCTTTAATTTAATTATGCTGGG + Intergenic
912065672 1:105738338-105738360 AACTTTAATTAATTTCTGGTGGG - Intergenic
913524629 1:119679105-119679127 ATCCTTGATTTATAGCTGGTAGG - Intronic
916507093 1:165437860-165437882 GTCTATAATTTGGTGCTGGCTGG + Intronic
916579968 1:166097919-166097941 TTCTCTATTTTTGTGCTGGTTGG - Intronic
916602782 1:166309450-166309472 AACTTTCATTCAGTGCTGATGGG - Intergenic
919193498 1:194253499-194253521 ACCTTCAATTTATAGCTGGTTGG + Intergenic
919205635 1:194419509-194419531 ATCTTTATAATAGTGCTGGGAGG + Intergenic
919550444 1:198979093-198979115 ATGTTTAATTTAGTTCTGAAAGG + Intergenic
920815299 1:209325620-209325642 AATGTGAATTTAGTGCTGGTTGG + Intergenic
921014915 1:211180533-211180555 AACTCTCATTTATTGCTGGTAGG - Intergenic
921460955 1:215426391-215426413 AACTTTTATATACTGCTGGTAGG - Intergenic
921521929 1:216166804-216166826 ATTTTTAATTTTCTGCTGGAGGG + Intronic
922055165 1:222035555-222035577 AACTCTAATTTATTGCTGGTGGG + Intergenic
922863165 1:228836810-228836832 GTGTTTTATTTAGTGATGGTGGG + Intergenic
1063178426 10:3572851-3572873 ATCTTTAATGTAGGGAAGGTAGG - Intergenic
1063851709 10:10199761-10199783 ATTTATAATTTAGTGCTGGAAGG + Intergenic
1063932945 10:11047413-11047435 ATCTTTAATTCAGGGCTGTCAGG + Intronic
1066036098 10:31486332-31486354 ATCTCTTATTTATTACTGGTGGG - Intronic
1066710274 10:38226214-38226236 ATCTTTAAATTATTACTGGTAGG + Intergenic
1067326198 10:45269225-45269247 ATCTCTGATTTAGTCCTGGGAGG - Intergenic
1067714641 10:48681165-48681187 ATCTTGAGTTTTGTTCTGGTTGG + Intergenic
1067857198 10:49804873-49804895 AACTCTCATTTATTGCTGGTGGG - Intergenic
1068371965 10:56128796-56128818 ATTTTTAATTCAGTATTGGTAGG + Intergenic
1068533316 10:58212754-58212776 ATCTTTGATGTAGTTCTTGTAGG + Intronic
1069242673 10:66162664-66162686 TGCTTTATTTTTGTGCTGGTTGG + Intronic
1069406886 10:68110626-68110648 ATTTTTAATTTAGTGTTTGTAGG - Intronic
1071245945 10:83763537-83763559 AACTTTTGTTTATTGCTGGTGGG + Intergenic
1072026107 10:91459237-91459259 ATCACTAATATATTGCTGGTGGG + Intronic
1073675475 10:105642603-105642625 ATCTTGAATTTAGTGCACTTTGG - Intergenic
1074437736 10:113448396-113448418 ATCATTCATTCATTGCTGGTGGG - Intergenic
1074437740 10:113448426-113448448 ATCATTCATTCATTGCTGGTGGG - Intergenic
1078173132 11:8945170-8945192 AACTTTCTTTTATTGCTGGTGGG - Intergenic
1078531103 11:12137280-12137302 AACTCTGATTTAGTCCTGGTGGG - Intronic
1078571897 11:12465954-12465976 AACTTTCATTTATTGCTGGTAGG - Intronic
1079273844 11:19014571-19014593 ATTTTTGATTCAGTGTTGGTGGG + Intergenic
1085162104 11:74357557-74357579 AGCTCTCATTTATTGCTGGTAGG + Intronic
1086389336 11:86346191-86346213 AGCTTTTATTTAATACTGGTAGG + Intergenic
1086874982 11:92084883-92084905 AACTCTAATTCATTGCTGGTGGG - Intergenic
1087077610 11:94139971-94139993 ATCCTCAATTTATAGCTGGTTGG + Intronic
1088377326 11:109156904-109156926 ATGTTGAATTTTGTTCTGGTGGG + Intergenic
1088388007 11:109281380-109281402 AGCTCTATTTTTGTGCTGGTTGG + Intergenic
1089239109 11:117059882-117059904 AACTCTCATTTACTGCTGGTGGG + Intronic
1091126269 11:133101600-133101622 AACTCTTATTTATTGCTGGTTGG + Intronic
1091382792 12:73366-73388 ATCATTTATTTAGTACTGTTTGG + Intronic
1091860642 12:3779363-3779385 AACTTTAATTCATTGCTGGGAGG - Intergenic
1093710718 12:22327339-22327361 ATCTTTGATTTGGTGCTGTGGGG - Intronic
1093727560 12:22532602-22532624 ATCTTTCTTTTAGTGTTGGAAGG - Intronic
1095211188 12:39497154-39497176 TGTTTGAATTTAGTGCTGGTAGG - Intergenic
1095390749 12:41703450-41703472 AACTTTCATATATTGCTGGTGGG + Intergenic
1095475866 12:42587221-42587243 ATCTTTAATTTGGTACTAATTGG - Intronic
1096744971 12:53720695-53720717 ATGTTTCATTTACTACTGGTAGG - Intronic
1097291661 12:57921714-57921736 AACTCTCATTTATTGCTGGTGGG + Intergenic
1098357516 12:69625717-69625739 GGCTTTTATTTATTGCTGGTGGG - Intergenic
1100141802 12:91627974-91627996 AACTCTCATTTACTGCTGGTGGG - Intergenic
1100344724 12:93716988-93717010 AACTCTCATTTATTGCTGGTAGG - Intronic
1100492565 12:95095311-95095333 ATCTTTAATTCAGCGCTAGATGG + Intronic
1102325559 12:111979958-111979980 AACTCTCATTTATTGCTGGTGGG + Intronic
1103109615 12:118264114-118264136 ATCTTTCATACACTGCTGGTGGG + Intronic
1105384762 13:19919457-19919479 ATCTCTCATTTATTGCTGGTGGG - Intergenic
1106014525 13:25855773-25855795 ATCTTTCATACACTGCTGGTGGG - Intronic
1106238489 13:27887021-27887043 ATCTTTCATATATTGCTGGTGGG + Intergenic
1106757006 13:32831691-32831713 AACTTTTATTTAATGTTGGTGGG - Intergenic
1107257240 13:38442613-38442635 AACTCTCATTTATTGCTGGTGGG - Intergenic
1108963491 13:56266802-56266824 ATCTCTAATTCTTTGCTGGTGGG + Intergenic
1110852584 13:80262455-80262477 TGCTTTATTTTTGTGCTGGTTGG + Intergenic
1111804232 13:93019466-93019488 ATCATTTATTTAGTGTTGGTGGG + Intergenic
1112817297 13:103287812-103287834 ATTTTTAATTTTGTACAGGTAGG + Intergenic
1113036403 13:106054002-106054024 ATCATTGATTTAGTTCTGGATGG - Intergenic
1113092985 13:106634296-106634318 ATATTTAACTTACAGCTGGTAGG + Intergenic
1114277259 14:21158072-21158094 ATTTTGAATTTAGTGCAGATTGG - Intergenic
1115093807 14:29610549-29610571 AACTTTAATTCATTGCTGGTGGG + Intronic
1116143279 14:41029315-41029337 AACTGTAACTTATTGCTGGTTGG - Intergenic
1116424350 14:44771351-44771373 ATCTCTCATATATTGCTGGTTGG - Intergenic
1116687882 14:48065366-48065388 ATATTTACTTTATTGCTGGCTGG - Intergenic
1117117491 14:52531199-52531221 AACTTTCATTCATTGCTGGTGGG + Intronic
1118051493 14:62034232-62034254 AACCTTAATATACTGCTGGTGGG + Intronic
1120446583 14:84605689-84605711 AACATAAATTTAGTGGTGGTAGG + Intergenic
1121804286 14:96802140-96802162 ATCTTTCATATGTTGCTGGTAGG + Intronic
1122777410 14:104127067-104127089 ATGTTTAAGTTATTTCTGGTGGG + Intergenic
1123915517 15:25021643-25021665 ACCTTTAATCTTGTGTTGGTAGG - Intergenic
1124092043 15:26614485-26614507 ATATATACTTTATTGCTGGTGGG + Intronic
1124176499 15:27429900-27429922 ATTATTTATTTAGTGCTGTTGGG + Intronic
1125126887 15:36234731-36234753 ATCTCTCATTCATTGCTGGTGGG + Intergenic
1127403731 15:58618890-58618912 ACCATTAGTTTACTGCTGGTGGG + Intronic
1130341191 15:83000429-83000451 ATCTTAAATTTAGCTCAGGTCGG - Intronic
1130404920 15:83590529-83590551 ATCACTAATATATTGCTGGTGGG - Intronic
1130723134 15:86409701-86409723 ATTTTTAATTTAATGCTTCTGGG - Intronic
1131660525 15:94510762-94510784 AACTTTTATATACTGCTGGTGGG + Intergenic
1132266254 15:100473678-100473700 AACTCTAATACAGTGCTGGTAGG + Intronic
1134543526 16:15089456-15089478 ATCTTAAATTTGGTGTTGATTGG - Intronic
1134782696 16:16912993-16913015 AACTCTCATTTACTGCTGGTGGG + Intergenic
1135361106 16:21815613-21815635 ATCTTAAATTTGGTGTTGATTGG - Intergenic
1138241283 16:55429167-55429189 ATGTTTCATTTATTGCAGGTTGG + Intronic
1139098917 16:63742251-63742273 ATCTCTTATTCATTGCTGGTGGG + Intergenic
1139928058 16:70502650-70502672 ATCTCTAATTTAGCCCTGGCAGG + Intronic
1140560750 16:75978058-75978080 ATCTTTATTTCACTGATGGTGGG + Intergenic
1143064340 17:4232731-4232753 AGCTTTAATTCAGTGCTGTCTGG - Intronic
1143429447 17:6869989-6870011 AACTTTCATTTATTGCTGGTGGG - Intergenic
1144139637 17:12336342-12336364 TGCTTTATTTTTGTGCTGGTTGG + Intergenic
1144255921 17:13466988-13467010 ATGCTTCATTTTGTGCTGGTGGG + Intergenic
1149443519 17:56695436-56695458 AACTTTCATTCATTGCTGGTGGG - Intergenic
1149716990 17:58800992-58801014 ATTTTTAATTTAATTCTGCTGGG + Intronic
1150565010 17:66331054-66331076 ATGTTTTATTTAGTGCTTTTGGG + Intronic
1156684564 18:39628977-39628999 ATCTTCAAGTTATTGCTAGTTGG + Intergenic
1158858286 18:61566205-61566227 AACTTTCATTTATTGCTAGTGGG - Intergenic
1159586995 18:70290557-70290579 ATATTTAATTTAGAGCTGAATGG - Intronic
1159949007 18:74465999-74466021 AACTTTCATTCATTGCTGGTGGG - Intergenic
1161730601 19:5958456-5958478 ATCTCTAAGTGAGTGCTGGTTGG + Intronic
1164400319 19:27897566-27897588 ATCCTTATTTAAGTGGTGGTGGG - Intergenic
1164489076 19:28690317-28690339 CTCTTTTATTTTGTGCTGTTTGG - Intergenic
1164665533 19:30031404-30031426 AACTTTCATTCATTGCTGGTGGG - Intergenic
1166350026 19:42192846-42192868 AGCTCTCATTCAGTGCTGGTGGG + Intronic
1166604213 19:44126493-44126515 TGCTTTATTTTTGTGCTGGTTGG + Intronic
1167110196 19:47456107-47456129 ATTTTTACTTTAGTAATGGTGGG + Intronic
925536284 2:4921258-4921280 AACTCTCATTTATTGCTGGTGGG + Intergenic
928872174 2:35992755-35992777 ATCCCTAATTCAGTGCTGCTAGG + Intergenic
928885805 2:36146781-36146803 ATATTTAATTTAGTTCAGCTGGG - Intergenic
929375272 2:41279186-41279208 ATCTTTCATACATTGCTGGTTGG - Intergenic
929421640 2:41796336-41796358 AACTCTCATTTACTGCTGGTGGG - Intergenic
929436403 2:41931946-41931968 ATGTTTAATTTCATGCTTGTAGG - Intergenic
930493044 2:52100985-52101007 GACTTTCATTTATTGCTGGTGGG - Intergenic
930960798 2:57259224-57259246 ATCTTAATTTTAGTGATGCTGGG - Intergenic
931494587 2:62788933-62788955 ATATTTGATTTACTGGTGGTAGG + Intronic
931598127 2:63973141-63973163 AACTCTTATTTATTGCTGGTGGG - Intronic
932840270 2:75075299-75075321 AACTCTTATTTACTGCTGGTGGG + Intronic
932946589 2:76240132-76240154 ATTTTTAATTTTGGGGTGGTTGG + Intergenic
933768217 2:85725497-85725519 CTCTTTACTATAATGCTGGTGGG + Intergenic
934122633 2:88855017-88855039 ATCATTCATATATTGCTGGTGGG - Intergenic
935835999 2:107054122-107054144 TTCTTCAATTTATTGCTGTTTGG - Intergenic
937693577 2:124782701-124782723 AAATTTAATTTATTGCTGGTGGG + Intronic
937959306 2:127442746-127442768 ATCTCTCATTCATTGCTGGTGGG - Intronic
938094663 2:128453640-128453662 ACCTTTGATTTATTTCTGGTTGG + Intergenic
939204506 2:139082992-139083014 ATATTTATTTAAGTGCTGATTGG - Intergenic
940596465 2:155799631-155799653 AATTTTAATTTAATGTTGGTGGG + Intergenic
940703768 2:157078343-157078365 ATTTTTTATTTTGTGCTGGAAGG - Intergenic
941553632 2:166947636-166947658 ACCTTTCATTTGTTGCTGGTGGG + Intronic
943121974 2:183747832-183747854 ATGTTTAATTGAATGGTGGTTGG - Intergenic
943288672 2:186041058-186041080 AGCTTTAATTTATTGATAGTGGG + Intergenic
943707129 2:191047360-191047382 ACCCTCAATTTATTGCTGGTTGG + Intronic
943849354 2:192697243-192697265 ATATTTAACTTAGTGTTGATGGG + Intergenic
944623680 2:201546656-201546678 ATCTTTCATACATTGCTGGTTGG + Intronic
945779100 2:214145607-214145629 ATCTTTAATTTGGTGGTGGGAGG + Intronic
948690768 2:239702706-239702728 AACTTTTATATACTGCTGGTGGG - Intergenic
949038551 2:241833319-241833341 TTCATTCATTTATTGCTGGTGGG + Intergenic
1168988821 20:2076723-2076745 ATCTCTCATTCATTGCTGGTGGG + Intergenic
1169098391 20:2923834-2923856 AGCTTTAATTCAATGCTGGCAGG - Intronic
1169394471 20:5217482-5217504 AGCTTTAATTTAGTGATACTTGG + Intergenic
1169643993 20:7788859-7788881 AACTTTCATTCATTGCTGGTGGG + Intergenic
1170065715 20:12307902-12307924 ATTTTTAAATTAGTTCTGATAGG + Intergenic
1174018665 20:47510949-47510971 ATCTTTAATTTGCTGCTGCTTGG + Intronic
1174084408 20:47995638-47995660 AGCTCTAATTTACTGCTGGCAGG - Intergenic
1176282393 20:64321393-64321415 ATCATTTATTTAGTACTGTTTGG - Intergenic
1177568660 21:22857704-22857726 AACTTTCATTTATTGCTGGTGGG - Intergenic
1178064636 21:28890618-28890640 AACTTTCATTCATTGCTGGTGGG + Intergenic
1178087767 21:29129764-29129786 AACTTTCATTCCGTGCTGGTGGG - Intronic
1180124663 21:45781515-45781537 ATCTTTCATATACTGTTGGTGGG + Intronic
1181375778 22:22456902-22456924 CTTTTTAATTTGGTGCGGGTGGG - Intergenic
1181431537 22:22884692-22884714 AGCTTGAATTTAGGGATGGTGGG + Intronic
1182581763 22:31317669-31317691 AACTTTCATTCATTGCTGGTAGG + Intergenic
1182915549 22:34026123-34026145 TTCTCTAATTTACTGTTGGTTGG + Intergenic
1184446326 22:44549286-44549308 ATCTCTAATTTACTGCTGTGGGG - Intergenic
1184942038 22:47775823-47775845 ATCTCTCATTTCCTGCTGGTGGG + Intergenic
949258170 3:2075356-2075378 AACTCTAATTCACTGCTGGTAGG + Intergenic
949372468 3:3350265-3350287 AACTCTCATTTATTGCTGGTGGG - Intergenic
950037021 3:9893540-9893562 AACTATAATTTATTCCTGGTTGG + Exonic
950786333 3:15439302-15439324 GTCTTTAACTTAGTGGTGATGGG + Exonic
950995189 3:17488588-17488610 AACTCTTATTTATTGCTGGTGGG - Intronic
952208391 3:31203455-31203477 TTATTTAATTTAGTGTTGGAAGG - Intergenic
952491145 3:33874205-33874227 AACTCTCATTCAGTGCTGGTGGG - Intergenic
953400277 3:42608292-42608314 ATCCCTAATTTACAGCTGGTTGG - Intronic
953500642 3:43430436-43430458 ACCTTGAATTTTGTGGTGGTGGG + Intronic
955786787 3:62549684-62549706 TTCCTTCATTTAGTGCTTGTGGG + Intronic
957898561 3:86455786-86455808 ATCTCTCATGTATTGCTGGTTGG + Intergenic
958490945 3:94772398-94772420 ATCTCTCATTCATTGCTGGTGGG + Intergenic
959547737 3:107616493-107616515 ATCATTCATATACTGCTGGTGGG - Intronic
959630427 3:108501259-108501281 ATCTTTAAATTGATGATGGTTGG - Intronic
959877107 3:111396098-111396120 AACTCTCATTTATTGCTGGTGGG - Intronic
961905900 3:130263116-130263138 ATCTTTCATTTAGAACTGGCGGG - Intergenic
962065975 3:131981145-131981167 TGCTTTATTTTTGTGCTGGTTGG + Intronic
962308184 3:134307263-134307285 GTCTGTAATTTAGGGGTGGTTGG + Intergenic
963694021 3:148541769-148541791 ATCATTCATATATTGCTGGTGGG - Intergenic
963886768 3:150591681-150591703 AACTCTAATTTATTGCTGGTGGG + Intronic
964145742 3:153460889-153460911 ATCTTGAATTTAATGCTTTTGGG + Intergenic
964255974 3:154774402-154774424 ATCTCTCATTCATTGCTGGTGGG - Intergenic
964264954 3:154885089-154885111 AACTTTCATTCATTGCTGGTGGG + Intergenic
964996648 3:162891054-162891076 AACTCTTATTTATTGCTGGTAGG + Intergenic
965270472 3:166611533-166611555 ATTTTTAATTTAGTTCTTCTTGG - Intergenic
965326570 3:167311810-167311832 AACTTTCATTAATTGCTGGTGGG + Intronic
965660142 3:171032553-171032575 ATCATTCATTTATTGCTGGTGGG - Intergenic
965731468 3:171776417-171776439 CTCTTTTATTTAGTTCTGATTGG + Intronic
966310689 3:178590187-178590209 CTCTCTTATTTAGTGCTGGAAGG + Intronic
966420831 3:179732679-179732701 ATCATCAATTTAGTGCTGTTTGG + Intronic
968030274 3:195477821-195477843 AACTCTCATTTATTGCTGGTGGG + Intergenic
970552043 4:17191882-17191904 ATCTTTAATTTACTGAGGGTTGG - Intergenic
971180975 4:24328260-24328282 ATCTTTGTTTTAATGCTGATTGG - Intergenic
971189277 4:24412125-24412147 AACTTTCATTCATTGCTGGTGGG - Intergenic
971738805 4:30493661-30493683 AACTCTCATTTATTGCTGGTGGG - Intergenic
972085911 4:35215493-35215515 AACTTTTATCTAGTGCTGATAGG + Intergenic
973138582 4:46737062-46737084 AACTCTCATTCAGTGCTGGTGGG - Intronic
974541365 4:63241632-63241654 AATTTTTATTTATTGCTGGTAGG - Intergenic
974990761 4:69085739-69085761 ATTTTTAATTCAATCCTGGTTGG + Intronic
976757775 4:88516600-88516622 ATTTCTCATTTAGAGCTGGTGGG + Intergenic
977030898 4:91881781-91881803 AACTCTTATTTATTGCTGGTGGG - Intergenic
978175398 4:105725446-105725468 AACTCTCATTTACTGCTGGTGGG - Intronic
978246746 4:106581360-106581382 ATCTTTGATCTAATGCTGATGGG + Intergenic
979582251 4:122374520-122374542 ATCTTTAAATGAGTGATGGTGGG - Intergenic
979652573 4:123152639-123152661 AACTTTCATTCACTGCTGGTGGG + Intronic
979794841 4:124834115-124834137 TGCTTTATTTTTGTGCTGGTTGG + Intergenic
980442163 4:132863338-132863360 AACTCTAATTCATTGCTGGTAGG + Intergenic
981554260 4:145975817-145975839 ATCTCTCATATATTGCTGGTGGG + Intergenic
982022764 4:151220509-151220531 ATCTATTATTTAGAGCTGGTGGG + Intronic
982075041 4:151730460-151730482 TGCTTTATTTTTGTGCTGGTTGG - Intronic
982218729 4:153106867-153106889 TACTTTATTTTTGTGCTGGTTGG + Intergenic
983246252 4:165290939-165290961 AACTTTCATTCACTGCTGGTAGG - Intronic
983442189 4:167801002-167801024 ATCATTAATTTACTGTTGATGGG - Intergenic
984337264 4:178408486-178408508 AACTTTTATTTATTGCTGGTGGG + Intergenic
986354385 5:6909382-6909404 ATGTTAACATTAGTGCTGGTTGG - Intergenic
986354394 5:6909484-6909506 ATGTTAACCTTAGTGCTGGTTGG - Intergenic
986395585 5:7326328-7326350 ATTTTGAATTTGGTGCTGGAAGG - Intergenic
986867064 5:12001898-12001920 ATCTTTATTTTTGTCCTGGCTGG - Intergenic
989006298 5:36816625-36816647 ATCTCTTATTCAATGCTGGTGGG + Intergenic
989382299 5:40821393-40821415 ATCTTTAACATAGAGCTAGTAGG - Intergenic
989723803 5:44562390-44562412 AACTCTAATTCACTGCTGGTAGG - Intergenic
990066542 5:51722603-51722625 AACTCTCATTTATTGCTGGTGGG - Intergenic
990110969 5:52324055-52324077 AACTTTCATATATTGCTGGTGGG + Intergenic
990932019 5:61102980-61103002 AACTTTTATACAGTGCTGGTTGG + Intronic
991507267 5:67338254-67338276 ATTTTGAATGCAGTGCTGGTAGG + Intergenic
991947235 5:71911019-71911041 ATCTCTGATGTATTGCTGGTTGG + Intergenic
991982430 5:72246639-72246661 ATCTTTAATTTAGTGCTGGTAGG + Intronic
992632719 5:78697522-78697544 ACCTTTCATATATTGCTGGTGGG - Intronic
993917089 5:93756413-93756435 TGCTTTATTTTTGTGCTGGTTGG - Intronic
994007415 5:94855228-94855250 ATCTGTAATTTAGTCCTGAATGG - Intronic
994238832 5:97396040-97396062 AGCTTTCATTCATTGCTGGTGGG - Intergenic
994883532 5:105529045-105529067 GTTTTTATTTTTGTGCTGGTTGG + Intergenic
995817849 5:116191829-116191851 TGCTCTATTTTAGTGCTGGTTGG - Intronic
995888983 5:116928691-116928713 AACTTTAATGCACTGCTGGTGGG + Intergenic
996631249 5:125635464-125635486 AACTCTCATTTATTGCTGGTAGG + Intergenic
996942789 5:129029276-129029298 ATATTTGTTTTAGTGATGGTAGG + Intronic
996963592 5:129281009-129281031 AACTTTCATTTATTGCTGGTGGG + Intergenic
1000220926 5:159213317-159213339 ATCTCTCATATACTGCTGGTGGG - Intergenic
1001968172 5:175929469-175929491 AACTCTCATTTATTGCTGGTGGG + Intronic
1002249272 5:177914341-177914363 AACTCTCATTTATTGCTGGTGGG - Intergenic
1003258845 6:4497786-4497808 ATCTTTAAAATAGTGGTGGTAGG - Intergenic
1004065448 6:12239535-12239557 ATATTTAAGTTATTGCAGGTAGG - Intergenic
1004813435 6:19286138-19286160 AGCCTTTATTTATTGCTGGTGGG + Intergenic
1004912054 6:20295496-20295518 AACTGTCATTTATTGCTGGTGGG - Intergenic
1005605711 6:27474895-27474917 AACTTTCATTCATTGCTGGTGGG + Intergenic
1006673485 6:35745001-35745023 ATCTTTCATATATTGCTGGTGGG + Intronic
1006723413 6:36176446-36176468 ATCATTCATATATTGCTGGTGGG + Intergenic
1007828468 6:44619653-44619675 AACATTAATTTAGTGGTGGTGGG + Intergenic
1007847612 6:44772982-44773004 ATCTTTGATTATGTGATGGTGGG - Intergenic
1008256176 6:49303034-49303056 AGCTCTATTTTTGTGCTGGTTGG - Intergenic
1009301000 6:62020518-62020540 ATCTATAATTTACTGATGGAGGG + Intronic
1009978985 6:70703691-70703713 ATATTTAATTGAGTACTGATTGG - Intronic
1010879555 6:81151080-81151102 ATTTTTTATTTGGTGCTTGTGGG - Intergenic
1011973802 6:93265749-93265771 ATCTTTAATTTAAGGCAGGATGG + Intronic
1013306844 6:108855674-108855696 ATCTCTCATTCATTGCTGGTGGG - Intronic
1013544497 6:111142750-111142772 AACTTTCATTTATTGCTGGTGGG + Intronic
1013931101 6:115534030-115534052 AACTTTCATTTATTGCTGGTGGG - Intergenic
1016196065 6:141342157-141342179 ATCTTTCATTCATTGCTGGTAGG - Intergenic
1016440705 6:144080383-144080405 TTCAGTAATTTAGAGCTGGTTGG + Intergenic
1019169517 6:170124447-170124469 GCCTTTATTTTAGTTCTGGTTGG + Intergenic
1019902698 7:4035279-4035301 AAAATTAATTTAGTGCTGGCTGG - Intronic
1020219069 7:6220627-6220649 ATCTTTCATACATTGCTGGTGGG + Intronic
1020746126 7:12079928-12079950 ATCATTAAAATAGTGCTGGAGGG + Intergenic
1023553506 7:41394525-41394547 AACTCTTATTTATTGCTGGTAGG - Intergenic
1024749069 7:52442543-52442565 ACCTTTCATTCATTGCTGGTGGG - Intergenic
1024786636 7:52914606-52914628 AACTATCATTTATTGCTGGTGGG - Intergenic
1024793931 7:53000780-53000802 AACTTTCATTCAGTGCAGGTGGG + Intergenic
1026811965 7:73475107-73475129 ACCTTTAATTCACTGCTGGTGGG + Intronic
1027593992 7:80150069-80150091 AGCTTTAATGTACTGTTGGTTGG + Intronic
1027770443 7:82399816-82399838 ACCTTTAATGTAGTGAAGGTAGG - Intronic
1028181916 7:87734171-87734193 ATCTTTCATACATTGCTGGTGGG + Intronic
1028192577 7:87869910-87869932 AACTTGCATATAGTGCTGGTGGG - Intronic
1028328957 7:89564274-89564296 ATCTTTTATTTATAGCTGGGTGG - Intergenic
1028770116 7:94609740-94609762 AACTTTTATTCATTGCTGGTGGG + Intronic
1029160760 7:98549690-98549712 ATCTTAAACCTAGTGCTGGGGGG - Intergenic
1030488054 7:110196175-110196197 TTTTTTAACTTAGTGATGGTGGG - Intergenic
1030872772 7:114777488-114777510 AGCTTTCATATATTGCTGGTGGG - Intergenic
1031428022 7:121631402-121631424 ATCTCTCATTCATTGCTGGTGGG - Intergenic
1031677592 7:124630575-124630597 ATCTTTGTTTTAGTGCTTCTGGG + Intergenic
1033896073 7:146072124-146072146 AACTTTTATATAATGCTGGTGGG - Intergenic
1037021643 8:13978723-13978745 ATCTTTTATTTATTGCAGGAGGG + Intergenic
1039063312 8:33589607-33589629 TTCTAAAATTTAGAGCTGGTGGG + Intergenic
1039853108 8:41388563-41388585 AACTCTCATTTATTGCTGGTGGG + Intergenic
1040761775 8:50855016-50855038 AACTGTAATTTATTGCTGGTGGG + Intergenic
1041180583 8:55243679-55243701 AACTCTCATTTATTGCTGGTGGG - Intronic
1041403508 8:57470206-57470228 AACTGTAATTTATTGCTGGTGGG - Intergenic
1041498690 8:58515929-58515951 AACTTGCATTTATTGCTGGTGGG - Intergenic
1041892202 8:62881846-62881868 AACTTTAATTTATTCCTGGTGGG - Intronic
1043330140 8:79106176-79106198 ATGTGGAAATTAGTGCTGGTAGG + Intergenic
1043379842 8:79690773-79690795 CTCTTTAATATATTGCAGGTGGG + Intergenic
1043628876 8:82301333-82301355 ATCTTTAATTTAGTGGTTTTAGG + Intergenic
1043714803 8:83468136-83468158 ATATTTATTTTAGTGAGGGTTGG - Intergenic
1044767817 8:95595692-95595714 AACTTTCATACAGTGCTGGTGGG + Intergenic
1044957589 8:97497741-97497763 ATCTTTCATGCATTGCTGGTGGG + Intergenic
1045432545 8:102126925-102126947 AACCTTCATATAGTGCTGGTGGG - Intergenic
1045720985 8:105110655-105110677 ATCTCTCATCTATTGCTGGTGGG - Intronic
1046391189 8:113574889-113574911 AACTTTCATTTATTTCTGGTGGG - Intergenic
1046883948 8:119341768-119341790 AACTCTCATTTATTGCTGGTGGG + Intergenic
1046925670 8:119785426-119785448 CTCTTTATTTTAAAGCTGGTGGG + Intronic
1047265564 8:123304744-123304766 CTCTATGATTTAGTGTTGGTAGG + Intergenic
1047585999 8:126273389-126273411 AACTCCAATTTATTGCTGGTGGG - Intergenic
1049067555 8:140329370-140329392 ATTTTTAATTTGTTGCTGCTGGG - Intronic
1050145584 9:2563728-2563750 AGCTCTCATTTATTGCTGGTGGG + Intergenic
1050300712 9:4255242-4255264 AACTCTCATTCAGTGCTGGTGGG + Intronic
1050674366 9:8035689-8035711 AACTTTCATATATTGCTGGTGGG + Intergenic
1051709459 9:19915542-19915564 ACCTTTAATATATTGCTGGTGGG - Intergenic
1052426357 9:28310034-28310056 AACTTTTATACAGTGCTGGTAGG + Intronic
1052537180 9:29761822-29761844 TGCTTTACTTTTGTGCTGGTTGG - Intergenic
1052625102 9:30964299-30964321 ATCTTTCATACATTGCTGGTGGG + Intergenic
1052838318 9:33268359-33268381 ATCTTTAAATTTATTCTGGTGGG - Intronic
1055272479 9:74576728-74576750 TTTTTTAGTTTCGTGCTGGTAGG + Intronic
1055613709 9:78049489-78049511 AACTCTAATTCATTGCTGGTGGG + Intergenic
1055879799 9:80987246-80987268 ATGTTTCATTTAGTGCCTGTGGG - Intergenic
1055905771 9:81292232-81292254 TGCTTTATTTTTGTGCTGGTTGG + Intergenic
1056038583 9:82636239-82636261 AGCTTTTATTTATTGCTGGTGGG - Intergenic
1056079795 9:83080027-83080049 ATTTTTAATTTACCACTGGTTGG + Intergenic
1057427354 9:94963389-94963411 GTGTTTAATTTAGTGTTGTTAGG + Intronic
1057783419 9:98068885-98068907 ATCATTCATATATTGCTGGTGGG + Intronic
1058039650 9:100289975-100289997 AACTTTCATTCATTGCTGGTAGG - Intronic
1060329798 9:122656782-122656804 ATTTTTGATTTAGTACTGTTTGG - Intergenic
1060570623 9:124635968-124635990 AACTTTTATTCATTGCTGGTGGG - Intronic
1061384907 9:130284023-130284045 AACTTTCATTCACTGCTGGTGGG - Intergenic
1062672675 9:137720796-137720818 ATTTTTACTTTAGAGCTGCTCGG + Intronic
1187202167 X:17145588-17145610 ATCTTGAATCTAGAACTGGTAGG - Intronic
1187341319 X:18424622-18424644 ATCTTTACATTTGTACTGGTTGG + Intergenic
1187964894 X:24601820-24601842 ATCTCTCATTTATTGCTGGTGGG + Intronic
1188261439 X:28029553-28029575 AACTTTAATTCATTGCTGGTGGG - Intergenic
1188342929 X:29027648-29027670 AACTCTAATTAATTGCTGGTGGG - Intronic
1188457837 X:30387581-30387603 GTTTATAATTTAGTGTTGGTGGG - Intergenic
1188849363 X:35112969-35112991 AACTCTCATTTATTGCTGGTGGG - Intergenic
1189218206 X:39345241-39345263 TGCTTTATTTTTGTGCTGGTTGG - Intergenic
1189316899 X:40062941-40062963 TTCTTTAATTTTCTGCTGTTTGG + Exonic
1190018158 X:46846661-46846683 ATCTCTCATATACTGCTGGTAGG - Intronic
1191080687 X:56506306-56506328 TGCTTTATTTTTGTGCTGGTTGG - Intergenic
1192801623 X:74470432-74470454 AACTCTCATTTAGTGCTGGTGGG - Intronic
1192968141 X:76202132-76202154 TGCTTTATTTTTGTGCTGGTTGG + Intergenic
1193077052 X:77365205-77365227 TGCTTTATTTTTGTGCTGGTTGG - Intergenic
1193107977 X:77700367-77700389 AACTATCATTTATTGCTGGTGGG + Intronic
1194027644 X:88773352-88773374 ATCTTTTATATATTGCTAGTGGG + Intergenic
1194188280 X:90801654-90801676 AGCTTTCATTTATTGCTGATGGG - Intergenic
1195271802 X:103239083-103239105 AACTCTGATTTATTGCTGGTGGG + Intergenic
1197120945 X:122891626-122891648 AACTTTAATCCAGTGCTGGGAGG - Intergenic
1197857398 X:130930676-130930698 ATCTTTCATACATTGCTGGTGGG + Intergenic
1198267747 X:135025212-135025234 ATCTCTCATATATTGCTGGTGGG - Intergenic
1198529516 X:137537254-137537276 ACCTTTCATGTATTGCTGGTGGG + Intergenic
1198769789 X:140117813-140117835 ATCTTGAATTGAGTGATGGCTGG - Intergenic
1199475772 X:148243356-148243378 AACTTTCATTCATTGCTGGTGGG + Intergenic
1200534867 Y:4383579-4383601 AGCTTTCATTTATTGCTGATGGG - Intergenic
1201469857 Y:14321020-14321042 ATCTTTTATACACTGCTGGTGGG - Intergenic