ID: 991985264

View in Genome Browser
Species Human (GRCh38)
Location 5:72278559-72278581
Sequence ATGAAGAAGCAGGATGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 599}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991985264_991985272 18 Left 991985264 5:72278559-72278581 CCAACCCCATCCTGCTTCTTCAT 0: 1
1: 0
2: 2
3: 61
4: 599
Right 991985272 5:72278600-72278622 ATTTGTTGTTTACCATTTTTGGG 0: 1
1: 0
2: 6
3: 73
4: 697
991985264_991985271 17 Left 991985264 5:72278559-72278581 CCAACCCCATCCTGCTTCTTCAT 0: 1
1: 0
2: 2
3: 61
4: 599
Right 991985271 5:72278599-72278621 AATTTGTTGTTTACCATTTTTGG 0: 1
1: 0
2: 4
3: 53
4: 676

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991985264 Original CRISPR ATGAAGAAGCAGGATGGGGT TGG (reversed) Intronic
900393165 1:2442649-2442671 GTGCAGAAGCAGCATGGTGTGGG + Intronic
900669208 1:3839858-3839880 ATGATGGGGCAGGATGGGGAGGG - Intronic
901002813 1:6157090-6157112 AGGAAGAAGAAGGGTGGGTTGGG - Intronic
901775761 1:11559620-11559642 GTGAAGAGATAGGATGGGGTGGG - Intergenic
902229628 1:15019677-15019699 ATGAAGAAACTGGCTGGGCTTGG - Intronic
902358324 1:15924861-15924883 ATGAGGACGCAGGAGGGTGTGGG + Intronic
902590345 1:17469514-17469536 ATGAAGAAGGGGGTGGGGGTGGG + Intergenic
903024395 1:20417150-20417172 ATGAAGAAGCAGGCTGAGAGAGG - Intergenic
903131167 1:21280360-21280382 ATAAAGAAACAGACTGGGGTGGG + Intronic
903213630 1:21831622-21831644 TGGAAGTAGCAGTATGGGGTTGG + Intronic
903761044 1:25699009-25699031 ATGAAGAAGCATGAAAGGCTGGG + Intronic
903905536 1:26683353-26683375 AGGAAGAAGCAGGCTGGGCATGG - Intergenic
903948737 1:26981231-26981253 ATGAAGCAGCAGGGTGGATTAGG - Intergenic
903961176 1:27058853-27058875 CTGTAGAGGTAGGATGGGGTGGG - Intergenic
904085985 1:27908446-27908468 GGGAAGAGGCAGGATAGGGTAGG + Intronic
904629094 1:31828201-31828223 ATTAAGAAGCCTGATGGGCTGGG - Intergenic
904642881 1:31943973-31943995 AGGAATCAGCAGGATGTGGTGGG + Intronic
904948157 1:34214434-34214456 AAGAGGAAGCAGGATAGGGTGGG + Intronic
905107124 1:35570622-35570644 AAGGAGAAGCAGGTTGGGGTTGG + Intergenic
905201318 1:36319164-36319186 AGTAAGGAGCAGGATGGGGTTGG + Exonic
905201578 1:36320271-36320293 CTGAGGAAGGAGGCTGGGGTGGG - Exonic
905233705 1:36530867-36530889 AGGCAGCAGCAGGCTGGGGTTGG + Intergenic
906175616 1:43769443-43769465 AGGAAGTAGCAGGATGGGGAGGG + Intronic
906253674 1:44331159-44331181 ATGAAGAGGCAGGAAGGTCTGGG - Intronic
906315344 1:44783472-44783494 ATGAAGATGAAGGAAGGGTTTGG - Intergenic
906690136 1:47787105-47787127 GTGAAGAACCATGATGGGGAAGG + Intronic
907166819 1:52419371-52419393 AAGAAGAAGAAGAATGGGTTTGG + Exonic
907184509 1:52599624-52599646 AAGAAGGAGCAGGATGGGCAGGG + Intergenic
907408514 1:54268742-54268764 ATGAAGCAACAGGATGGAGCAGG + Intronic
907491301 1:54810570-54810592 CTGGGGAAGCAGGATGGGGCGGG - Intronic
907525551 1:55052001-55052023 ATGAAGGAGCAGGATGACTTGGG + Intronic
907632385 1:56095670-56095692 GAAAAGAAGCAGGATGGGGCAGG - Intergenic
908463876 1:64372590-64372612 ATAAATAAGCAGAATGGGCTGGG + Intergenic
908536491 1:65083275-65083297 GGGAAGAAGCAGGATTGTGTAGG + Intergenic
909296094 1:73950852-73950874 ATGAACAAGCAGGATAGTGTAGG - Intergenic
909699104 1:78500595-78500617 AGAAGGAAGCAGGATTGGGTAGG - Intronic
910243904 1:85118789-85118811 AGGAAGAAGGAGGTTGGGGAAGG + Intronic
910259427 1:85281446-85281468 GTGAAGATGGAGGCTGGGGTGGG - Intergenic
910965787 1:92806774-92806796 ATGAAAAAGCAGGCTGGGCTTGG + Intergenic
911008757 1:93255783-93255805 AGGAAGAAGAAGGAGGGGGGAGG + Intronic
911394076 1:97284668-97284690 ATGAAGTAGCAGGATGGGAGTGG - Intronic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
913122345 1:115753664-115753686 ATGAAGAGACTGGATTGGGTGGG - Intronic
913340858 1:117756984-117757006 ATGAAGAAGAGGGATGGTTTGGG + Intergenic
913686478 1:121236718-121236740 AGGATTAAGCAGAATGGGGTTGG + Intronic
914038329 1:144024358-144024380 AGGATTAAGCAGAATGGGGTTGG + Intergenic
914151126 1:145043550-145043572 AGGATTAAGCAGAATGGGGTTGG - Intronic
914863153 1:151403216-151403238 ACAAAAAAGCAGGGTGGGGTGGG + Exonic
915119494 1:153619994-153620016 AAGAAGAAGCAGGAAGGGTGCGG + Intronic
915362297 1:155293433-155293455 GTGAAGATGCAGCATGCGGTAGG - Exonic
915930872 1:160060185-160060207 CTTAAGAAGGAGGATGGGGTAGG + Intronic
915953432 1:160205263-160205285 ATGGAGAGGCAGGAGGGGGCGGG - Intergenic
916271015 1:162941429-162941451 ATGAAAAAGCAGGATAAGGAAGG - Intergenic
916611547 1:166396725-166396747 ATGGTGAAGCAGGATGGGAGGGG + Intergenic
916808545 1:168284129-168284151 ATGAAGTAGTAGAATGGGGGAGG - Intronic
916894785 1:169151317-169151339 GTGAAGTGGCAGGATGGAGTGGG + Intronic
917269541 1:173258166-173258188 ATAAAAAAGCAGGATTGGGGAGG + Intergenic
917793671 1:178516217-178516239 GTGAATAAGGAAGATGGGGTTGG - Intronic
917963576 1:180164912-180164934 GAGAGGAAGCAGGAGGGGGTTGG + Intronic
918038078 1:180894775-180894797 CTGAAGAAACTGGATGGGTTAGG + Intergenic
918288290 1:183080429-183080451 CTGAAGTGGCAGGATGGGGTGGG + Intronic
918713688 1:187763310-187763332 ATGAAGAAAGAGTATTGGGTGGG - Intergenic
918761864 1:188420589-188420611 AGGAAGAAGGAGGAAGGGGAAGG - Intergenic
919192157 1:194235603-194235625 ATGAAGAAACAGCATTGAGTTGG + Intergenic
919549806 1:198970934-198970956 ATGGCCAAGCTGGATGGGGTTGG + Intergenic
919983407 1:202656734-202656756 ATGAAGCAGGAGGTTGGGCTGGG - Intronic
922008676 1:221558604-221558626 ATGAGTAAGCATGATGGGGCAGG - Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
922910967 1:229216849-229216871 TTGAAAAATCAGGCTGGGGTCGG - Intergenic
923495584 1:234521719-234521741 ATGGAGAAGCAGCAAGGGGCAGG - Intergenic
923538488 1:234871224-234871246 AAGAAAAAGCATGATGTGGTGGG - Intergenic
923660275 1:235951335-235951357 TTGAAGATGCAGGATGGAGCTGG - Intergenic
924150437 1:241124101-241124123 AAGAAGAACCAGGATGGGCATGG + Intronic
1063671574 10:8103668-8103690 ATGAAGAATGAAGGTGGGGTTGG - Intergenic
1063696495 10:8340510-8340532 TAGAAGAACCAGGATGGGATGGG - Intergenic
1063830021 10:9942114-9942136 AGCAAGGAGGAGGATGGGGTTGG - Intergenic
1065655954 10:27950045-27950067 ATGGAGAAGCTGTGTGGGGTAGG - Intronic
1065893371 10:30139705-30139727 ATAAAAATGCAGGATGGGGCTGG + Intergenic
1067571709 10:47376621-47376643 GGGGAGAAGGAGGATGGGGTGGG - Intronic
1067829996 10:49606120-49606142 GTGGAGAAGCAGGCTGGTGTTGG - Intergenic
1067902330 10:50255238-50255260 AAGAAGAAGTAGGAAGGGGGAGG + Intergenic
1068199188 10:53761050-53761072 AAGAGGAAGCAGGTTGGGGTGGG + Intergenic
1069447063 10:68482822-68482844 ATGAAGAAGCTGGACATGGTGGG - Exonic
1069508604 10:69023267-69023289 ATCCAGACGCAGGATGGTGTGGG - Intergenic
1069630836 10:69896210-69896232 AGGAAGGAGCAGGCGGGGGTGGG - Intronic
1069987326 10:72293308-72293330 AAGAGGAAGCAGAATGGGGAGGG - Intergenic
1070052565 10:72903577-72903599 AGAAGAAAGCAGGATGGGGTGGG - Intronic
1070425074 10:76278923-76278945 ATAAACAAGCATGATGGAGTTGG + Intronic
1070672090 10:78385090-78385112 AAGAATGGGCAGGATGGGGTAGG + Intergenic
1070731339 10:78830798-78830820 AGGATGATGCAGGATAGGGTGGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071533876 10:86411489-86411511 AGGAAGAAGCCGGGTGGAGTGGG - Intergenic
1071601838 10:86962299-86962321 ATGAGGAACCTGGGTGGGGTAGG - Intronic
1072069133 10:91899728-91899750 AGGAGGAAGGAGGATAGGGTAGG - Intergenic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072696727 10:97609441-97609463 AGGGTGAGGCAGGATGGGGTAGG - Intronic
1072808952 10:98445125-98445147 ATGAGGCATCAGGATGGGGGTGG + Intronic
1073153622 10:101329018-101329040 TTGAAGAAGCAGGTTTGGTTTGG - Intergenic
1073645129 10:105293838-105293860 ATGAAGAAGCTGGATATGGTAGG - Intergenic
1074084070 10:110194223-110194245 TTGGAGAAAGAGGATGGGGTAGG + Intergenic
1074567378 10:114592852-114592874 CTGAAGAAGAAGGTTGGGGTGGG + Intronic
1074776301 10:116770557-116770579 ATGAGGCAGCAAGGTGGGGTGGG + Intergenic
1074853345 10:117456006-117456028 AAGAGCAAGCAGGAGGGGGTGGG + Intergenic
1074887362 10:117704713-117704735 AGTAAGAAGCAGGCTGGGATTGG - Intergenic
1075627597 10:123973737-123973759 CTGAAGGAGCTGGATGGGGCTGG - Intergenic
1075705516 10:124497909-124497931 TTGAAGAAGCAGGATGCTGTGGG - Intronic
1076399769 10:130174328-130174350 AAGAAGCAGCAGCCTGGGGTGGG + Intronic
1077076282 11:703629-703651 CTGGAGACGCAGGATGGGGTAGG + Intronic
1077500311 11:2907066-2907088 AGGAAGAAGGAGTCTGGGGTTGG + Intronic
1078619063 11:12891273-12891295 TTTAAAAAGCAGGGTGGGGTGGG - Intronic
1078738178 11:14041185-14041207 GGGAAGAAGGAGGATGGGGGAGG - Intronic
1079328638 11:19515777-19515799 AGGTGGAAGCAGGGTGGGGTGGG + Intronic
1080111490 11:28572987-28573009 ATAAAGAAGGAGGTGGGGGTGGG + Intergenic
1080381938 11:31780957-31780979 ATGAAAAAGCTTTATGGGGTAGG - Intronic
1081513972 11:43806300-43806322 AAGATGACCCAGGATGGGGTTGG - Intronic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1081615562 11:44588763-44588785 ATGAAAAAGCTGGCTGGAGTAGG + Intronic
1082997358 11:59264572-59264594 ATGAAGAAACAGGCTCAGGTGGG - Intergenic
1083749414 11:64753182-64753204 TTGAAGCTGCAGGATGAGGTTGG + Exonic
1083832854 11:65243996-65244018 ATGGGGCAGCAGGCTGGGGTGGG - Intergenic
1083964620 11:66035796-66035818 ATGAAGGTGGAGGATGGGGGTGG + Intergenic
1084128109 11:67114414-67114436 ATGAACATGGAGGAGGGGGTGGG + Intergenic
1084503638 11:69552085-69552107 ATGATAAACCAGGCTGGGGTGGG + Intergenic
1085843217 11:80037557-80037579 AGGAAGAAAGAGAATGGGGTAGG - Intergenic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1087512411 11:99114438-99114460 AAGAAGAAGGGGGATGGGATGGG - Intronic
1088756761 11:112891370-112891392 AAGAAGAAGCAGGCAGGGATTGG + Intergenic
1089132829 11:116225442-116225464 GTAAAGAGGGAGGATGGGGTGGG - Intergenic
1091287173 11:134413861-134413883 GTGCAGAAGCAGGATGGGCGGGG + Intergenic
1091317894 11:134628289-134628311 ATGCAGAAACAGTATGGGGCAGG - Intergenic
1091364346 11:135005207-135005229 ATGCAGAGGAGGGATGGGGTGGG - Intergenic
1091591408 12:1845070-1845092 AGGGAGAAGCAGGGTGGGGGTGG + Intronic
1091857668 12:3752713-3752735 ATGAAGAGGCTGGATGAGGCTGG + Intronic
1091905106 12:4179375-4179397 ATGAAGAAGAAGGAGGGGAGGGG + Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092314813 12:7399420-7399442 AGGAAGAAGAAGAATGGGGGAGG - Intronic
1092372789 12:7931090-7931112 CTGAAGAAGCAGGCTGAGGCCGG - Intronic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092989892 12:13886534-13886556 ATGAACAAGCAGGAAGGGCCAGG + Intronic
1093209765 12:16293902-16293924 AGGAAAAAGCAGGTTGGGGTCGG + Intergenic
1093315727 12:17647507-17647529 ATGGTGGAGCAGGAGGGGGTGGG - Intergenic
1094465067 12:30744409-30744431 GTGATGAAGCTGGAGGGGGTAGG - Intronic
1095302626 12:40603315-40603337 ATGAAGAGGCAGTAAGGGGTAGG - Intergenic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096652437 12:53068470-53068492 ATGGAAGAGCAGGATGGGGTGGG + Intronic
1096866227 12:54565214-54565236 ATGAAGCAGAAGGCTGGGGTGGG + Intronic
1098098956 12:66992289-66992311 ATGAAGAAGCAGGCTGCATTTGG + Intergenic
1098219858 12:68257764-68257786 ATGAATAAGTAAGATGTGGTCGG - Intergenic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100558704 12:95724822-95724844 ATGAAGAACAAAGATGGAGTAGG - Intronic
1101422377 12:104560119-104560141 ATGATGAGGCTGGATTGGGTGGG + Intronic
1101800929 12:108021499-108021521 ATGAAGGAGCAGGAGGAGGAAGG - Intergenic
1103235485 12:119368959-119368981 ATGAAGAAAGAGGAATGGGTGGG + Intronic
1103764919 12:123272824-123272846 AGGAAGAAGCAGGCCTGGGTGGG - Intergenic
1103902481 12:124310566-124310588 GTTGAGGAGCAGGATGGGGTGGG + Intronic
1104171118 12:126281723-126281745 ATGAAGAGAAATGATGGGGTGGG + Intergenic
1104277855 12:127346455-127346477 ATGAAGAAGGAGGAAGGTATCGG + Intergenic
1105544124 13:21339456-21339478 CTGAAGAATGAGGATGGGGCGGG - Intergenic
1105934694 13:25088215-25088237 ATGAACAAGCACAATGGGATGGG - Intergenic
1107401090 13:40069965-40069987 AGAAAGAAGCATGATGAGGTGGG + Intergenic
1107604072 13:42040961-42040983 AAGGAGAAGCGGGAGGGGGTGGG - Intronic
1108356562 13:49633729-49633751 CTGAAGAACCAGGATGGGACGGG + Exonic
1108681097 13:52781064-52781086 ATGCAGATGCAGGCTGGGGAAGG + Intergenic
1108999870 13:56785835-56785857 TTGAAGAAGCAGGAAGGAATAGG + Intergenic
1109317426 13:60766781-60766803 ATGAAGAAGAGGGATGGTTTTGG + Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110700383 13:78540620-78540642 AAGAAGAAGGAGGATGGGGAGGG - Intergenic
1111684554 13:91486244-91486266 ATAAAGCAGCAGGGTCGGGTAGG - Intronic
1112654573 13:101436655-101436677 AGGAAGAAGCAAGATTGGGCAGG + Intergenic
1112992772 13:105534361-105534383 TTGAAGAAACAGTAAGGGGTAGG + Intergenic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1114794706 14:25700452-25700474 ATGAAGCCGGAGGATGGGGCAGG - Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1115831752 14:37350370-37350392 AAGAAAAAGCAGAATGGGCTGGG - Intronic
1115962524 14:38851767-38851789 ATGAAGCAGGGGGGTGGGGTGGG - Intergenic
1116001094 14:39243573-39243595 ATGAAGAACCAGGCTGGGGGTGG + Intronic
1116481792 14:45399761-45399783 ATGAATAGGCAGGATGGGACTGG + Intergenic
1117344058 14:54815625-54815647 ATCAGGAAGCAGGATGGGCCTGG - Intergenic
1118594182 14:67423359-67423381 ATGAAGAAGCTGGCTGTGGAGGG - Intergenic
1118839662 14:69500975-69500997 CTGCAGATCCAGGATGGGGTGGG + Intronic
1119501161 14:75128392-75128414 CTGAAAAAGCAGGATGTGATGGG + Intergenic
1119557651 14:75566057-75566079 AGGAGGAGGCAGGATGGGGGTGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120399644 14:84013511-84013533 ATGAAGTAGCATGATGGGAGAGG - Intergenic
1120831440 14:89000891-89000913 ATGAAGGAGTAGGAGGGGGAAGG - Intergenic
1120904920 14:89611940-89611962 AAGAAAAAGCAGGATGGGTTGGG - Intronic
1120938486 14:89921642-89921664 ATGGAGGAGAACGATGGGGTAGG + Intronic
1121081936 14:91115312-91115334 CTGAGGAAGCAGGAAGGGGAAGG + Intronic
1121495776 14:94390598-94390620 ACCAAGAAGGAGGAGGGGGTCGG - Exonic
1121592855 14:95131863-95131885 ATGAAGAAGAAAGGTGGTGTAGG - Intronic
1121817353 14:96938835-96938857 ATGGACCAGCAGGATGGGGGTGG - Intergenic
1122125748 14:99577575-99577597 GGGAAGGTGCAGGATGGGGTGGG + Intronic
1122846553 14:104503217-104503239 GAGAAGAAGCAAGATGGGGGAGG - Intronic
1123887587 15:24742162-24742184 ATGTAGAAGCAAGAGGGGCTAGG - Intergenic
1125546951 15:40512822-40512844 ATGAGGATGCAGGCTGGGATTGG - Intergenic
1125722981 15:41853950-41853972 AGGCTGAAGCAGGCTGGGGTGGG + Intronic
1125845731 15:42851339-42851361 CAGAAGAAGCAGGCAGGGGTCGG + Intronic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1126302839 15:47219211-47219233 GTAAAGAAGCTGGATGGAGTTGG + Intronic
1127735459 15:61835034-61835056 AGGAGGAAACAGAATGGGGTAGG + Intergenic
1127901536 15:63344798-63344820 ATGCAATTGCAGGATGGGGTGGG - Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129050126 15:72774278-72774300 ATGAGGAGGAAGAATGGGGTGGG + Intronic
1129546756 15:76403921-76403943 AGGATGGAGTAGGATGGGGTAGG + Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1131035606 15:89220045-89220067 ATGCAGGAGCAGGATGGTGAAGG - Intronic
1131284836 15:91048185-91048207 AAGAAGAAGAAGGAGGGGGAGGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131641898 15:94301988-94302010 ATGAAGAAGAAGGAAGGAGTTGG + Intronic
1133680046 16:8112866-8112888 ATCTAGAAGCAAGATGGAGTTGG - Intergenic
1134066709 16:11233108-11233130 ATGAAGAGGGAGGAGGGGGTTGG - Intergenic
1134252594 16:12584970-12584992 CTGAAGGAGCAGGGTGGGGGAGG - Intergenic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134567795 16:15266153-15266175 ATTAAAAAGCAGGGTGGGCTGGG - Intergenic
1134734640 16:16490200-16490222 ATTAAAAAGCAGGGTGGGCTGGG + Intergenic
1134932832 16:18221706-18221728 ATTAAAAAGCAGGGTGGGCTGGG - Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1136356327 16:29746660-29746682 AAGACAAGGCAGGATGGGGTGGG - Intergenic
1136427457 16:30178594-30178616 ATGGAGAAGGCGGAGGGGGTAGG + Intergenic
1136684655 16:31986980-31987002 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1136785279 16:32930516-32930538 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1136786554 16:32938554-32938576 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1136883214 16:33915240-33915262 ATGTAGGAGCGGGATGGGGACGG + Intergenic
1136884503 16:33923288-33923310 ATCAACCAGCAGGATGAGGTGGG - Intergenic
1137525992 16:49236762-49236784 ATGAAGATGGAGGAGGGGGGTGG + Intergenic
1137775670 16:51052481-51052503 AGGAAGAAACAGAATGGGGCAGG - Intergenic
1138835414 16:60428876-60428898 AAAGAGAAGGAGGATGGGGTGGG + Intergenic
1139510692 16:67426921-67426943 ATGAAGATTGAGGATGTGGTGGG + Intergenic
1140520845 16:75580182-75580204 CTGAAGAAGAATGATGTGGTTGG + Intergenic
1140651568 16:77094128-77094150 ATGAAGAGGAAGGAAGGGGGAGG - Intergenic
1140963623 16:79942304-79942326 ATGAAGAGGCAGCAAGGGGGTGG - Intergenic
1141573228 16:84947412-84947434 ATCAAGAAGCAGGTGGGGTTCGG + Intergenic
1141594123 16:85087130-85087152 CTGAAGAAGCAGGCTGTGATTGG + Exonic
1141808451 16:86357871-86357893 ATGAAGATGAAGGCTGAGGTTGG + Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1203087936 16_KI270728v1_random:1194525-1194547 ATCAACCAGCAGGATGAGGTGGG + Intergenic
1203088789 16_KI270728v1_random:1200220-1200242 ATGTAGGAGCGGGATGGGGACGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143167745 17:4906201-4906223 CTGAAGAAGGATCATGGGGTTGG + Intergenic
1143505433 17:7362088-7362110 ATGAAAAAGCAGGAGGTGTTTGG + Intergenic
1143622178 17:8087009-8087031 ATGAAGGAGCAGGATGGAGAAGG + Intronic
1143877475 17:10003109-10003131 ATGAAGCAGAAGGCTGGGGCTGG + Intronic
1144010922 17:11147727-11147749 ACAAAGAAGCAAGATGGGATAGG + Intergenic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1144311130 17:14015302-14015324 AAGAAGAAGCCTCATGGGGTCGG + Intergenic
1144705055 17:17362718-17362740 ATGAATAAGCAGGGTGGCGCAGG - Intergenic
1146686338 17:34844009-34844031 ATAAAGAAGGTGGTTGGGGTAGG + Intergenic
1147445230 17:40471286-40471308 AGGAAGAATGAGGAGGGGGTAGG - Intergenic
1147498214 17:40937605-40937627 ATAAAGAAGCAGTCTGGGGGCGG + Intronic
1147605537 17:41771981-41772003 ATGAGGATGCAGGCTGGGGATGG + Intronic
1148149505 17:45388361-45388383 ATGAGGACGCGGGATGGGGAAGG + Intergenic
1148458677 17:47825030-47825052 AAAAAGAATCAGGATGAGGTTGG + Intronic
1148698775 17:49576139-49576161 CTGAAGGAGCAGGAAGGGGAAGG + Exonic
1148700407 17:49583343-49583365 AGGCAGAGGCAAGATGGGGTGGG + Intronic
1148919433 17:51017458-51017480 ATCAAGAAGCAGGGTGATGTAGG + Intronic
1149580716 17:57748692-57748714 ATGAAGGCATAGGATGGGGTGGG - Intergenic
1149600684 17:57891246-57891268 GGGGAGAAGCAGGTTGGGGTCGG - Intronic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1150449151 17:65251388-65251410 ATGAAGATCCAGGAGGGAGTGGG + Intergenic
1150645339 17:66974395-66974417 TTGAAAAGGCAGCATGGGGTAGG + Intronic
1151413635 17:73947513-73947535 ATGAAGAGGTAGGTAGGGGTGGG + Intergenic
1151496625 17:74461943-74461965 ATCATGGATCAGGATGGGGTGGG - Intergenic
1152243810 17:79175026-79175048 AGGAAGAGGCAGGAGGGGCTGGG - Intronic
1152374454 17:79911919-79911941 CTGAAGCACCAGGATGGGGCGGG - Intergenic
1152928056 17:83096897-83096919 CTGAAGCAGCAGGCTGGGGCTGG + Intergenic
1153440311 18:5110459-5110481 AAGAAGCAGGAGGATGGGGTGGG + Intergenic
1153557725 18:6333617-6333639 ATGGAGAAGCAGGATGCAGGTGG + Intronic
1153701072 18:7693822-7693844 ATGCAGACACAGGGTGGGGTTGG + Intronic
1153779075 18:8478495-8478517 AGGAAGGACCAGGATGGGGTGGG + Intergenic
1154285722 18:13054605-13054627 ATGAAGAAACAGGTTGAGGGAGG - Intronic
1155243287 18:23883650-23883672 ATAAAGCTGCAGGATGGGGCGGG - Intronic
1156969806 18:43140430-43140452 ATGAATCAGCAGGATGTGGGTGG + Intergenic
1157442843 18:47723512-47723534 ATGGAGAAGGAGGATGGAGCTGG - Intergenic
1157884271 18:51351327-51351349 ATGAAGAAGCTGGCTGGGCATGG - Intergenic
1157991769 18:52504800-52504822 CTGGAGAAGCAGGCTGAGGTTGG - Intronic
1160278149 18:77459048-77459070 ATGAAGAATCAGGCTGGTGCAGG + Intergenic
1160309816 18:77778789-77778811 ATGGAGTTGCAGGAAGGGGTGGG + Intergenic
1160611204 18:80086793-80086815 TAGGAGAAGCAGGATGGGGAGGG - Intronic
1160622981 18:80183577-80183599 CTGATGAAGCAGGATGAAGTGGG - Intronic
1160676619 19:394575-394597 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676758 19:395194-395216 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676783 19:395294-395316 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160676808 19:395394-395416 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695196 19:480499-480521 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1160695369 19:481421-481443 ATGGAGAAGGATGATGGGGAAGG + Intergenic
1161509622 19:4663246-4663268 CTGTAGAATGAGGATGGGGTGGG - Intronic
1161509651 19:4663378-4663400 GTGTAGAATGAGGATGGGGTAGG - Intronic
1161509661 19:4663425-4663447 GTGTAGAATGAGGATGGGGTGGG - Intronic
1161509672 19:4663466-4663488 CTGTAGAATGAGGATGGGGTGGG - Intronic
1161509682 19:4663511-4663533 GTGTAGAATGAGGATGGGGTGGG - Intronic
1161509708 19:4663601-4663623 CTGTAGAATGAGGATGGGGTGGG - Intronic
1161509739 19:4663730-4663752 TTGTAGAATGAGGATGGGGTGGG - Intronic
1161509752 19:4663775-4663797 GTGTAGAATGAGGATGGGGTGGG - Intronic
1161509763 19:4663822-4663844 GTGCAGAATGAGGATGGGGTGGG - Intronic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163628692 19:18405284-18405306 AGGAAGGAGGAGGCTGGGGTGGG - Intergenic
1163672363 19:18636675-18636697 AAGTAGGCGCAGGATGGGGTTGG - Intergenic
1163915182 19:20235299-20235321 GTAAATGAGCAGGATGGGGTGGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166875180 19:45892592-45892614 AGGAAGGAGCAGGGTGGGGGAGG - Intronic
1166901534 19:46067672-46067694 ATGAACAAGCAGAATGGAGGAGG + Intronic
1167061259 19:47148236-47148258 CTGAAGAAGCAGGATGGAATGGG + Intronic
1167474546 19:49692150-49692172 ATGAAGGAGGAGGAGGGGCTGGG + Intronic
1167532343 19:50025901-50025923 CTGAAGAAGCAGGAGGAGATGGG + Exonic
1167797070 19:51716481-51716503 ATGATGACTGAGGATGGGGTTGG - Intronic
1168277924 19:55287323-55287345 CTGGAGAGGGAGGATGGGGTAGG - Intronic
1168565121 19:57416117-57416139 AGAAAGAAACAGGATTGGGTTGG + Intronic
1168685933 19:58349683-58349705 ATGAAGGAGAGAGATGGGGTTGG + Intronic
926305555 2:11635352-11635374 ATGAAGAAGCAGATCGTGGTGGG + Exonic
927137852 2:20110462-20110484 ATGAAGTTGCAGTCTGGGGTTGG + Intergenic
927220332 2:20701860-20701882 ATGGAGAAGCCAGATGAGGTTGG - Intronic
927700601 2:25265991-25266013 AAAAAGAGGCAGGGTGGGGTAGG - Intronic
928000664 2:27520472-27520494 GTGAAGAAGTAGGAAGGGGAGGG + Intronic
928458557 2:31448277-31448299 ATCATGAGGCAGGGTGGGGTTGG + Intergenic
928711522 2:34011861-34011883 GTGAATAAGCAGGATGGCGGCGG - Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931752394 2:65341352-65341374 ATGGAGAAACATGATGGGGGAGG + Intronic
931991785 2:67797475-67797497 CTGATGCAGCAGGAGGGGGTGGG + Intergenic
933014784 2:77111592-77111614 AGGACCAAGTAGGATGGGGTAGG - Intronic
933182787 2:79245950-79245972 ATGAAGAAGCAGGCTGGGTTTGG - Intronic
933222762 2:79709745-79709767 ATGGAGAAATAGGATGGGGTAGG + Intronic
934138473 2:89020597-89020619 ATGAGGGAGGATGATGGGGTGGG - Intergenic
934144558 2:89078696-89078718 ATGAGGGAGGATGATGGGGTGGG - Intergenic
934153522 2:89172957-89172979 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934153949 2:89177042-89177064 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934155567 2:89196742-89196764 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934158140 2:89222344-89222366 ATGAGGAAGGAGAATAGGGTGGG - Intergenic
934159475 2:89234824-89234846 ATGAGGGAGGAGGAGGGGGTGGG - Intergenic
934207802 2:89947607-89947629 ATGAGGGAGGAGGAGGGGGTGGG + Intergenic
934209123 2:89960080-89960102 ATGAGGAAGGAGAATAGGGTGGG + Intergenic
934211757 2:89986017-89986039 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213285 2:90004893-90004915 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934213714 2:90008975-90008997 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934224694 2:90121853-90121875 ATGAGGGAGGATGATGGGGTGGG + Intergenic
934230771 2:90179956-90179978 ATGAGGGAGGATGATGGGGTGGG + Intergenic
934789439 2:97046217-97046239 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934817033 2:97336323-97336345 ATGAGGGAGGAGAATGGGGTGGG - Intergenic
934820663 2:97372161-97372183 ATGAGGGAGGAGAATGGGGTGGG + Intergenic
934987335 2:98897093-98897115 ATAAAGGAGCAGCATGGGGGAGG - Intronic
937250876 2:120522914-120522936 AAGAACAAGCAGCATGGGGCTGG + Intergenic
937278699 2:120702841-120702863 AGGAAGGAGCAGAATGAGGTCGG - Intergenic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
938128381 2:128690676-128690698 ATGAAGGAGCAAGAAGGGGGTGG - Intergenic
938588184 2:132712272-132712294 TTGAAGAATCAGGTTTGGGTGGG - Intronic
940027938 2:149228388-149228410 GTGAGGAAGCAAGATAGGGTAGG + Intergenic
940054681 2:149501011-149501033 ATGATGAAGAAGGACAGGGTAGG - Intergenic
941006286 2:160250635-160250657 ATGAAAAAGCACTATGGGTTTGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941213466 2:162673458-162673480 ATTAAGAAGCATGACAGGGTAGG - Intronic
941940986 2:171037144-171037166 ATTAAGAAGCATGATGGGCCTGG + Intronic
942314713 2:174687071-174687093 GTGAAGAATCAGGATGTGTTGGG + Intergenic
942958813 2:181805240-181805262 ATAAAGAAGAAGTATGGGCTTGG + Intergenic
943330681 2:186555381-186555403 ATGCAGAAGCAGGAAGGGCTTGG - Intergenic
944631594 2:201631597-201631619 ATAAAGAATCAGGCAGGGGTGGG + Intronic
944808570 2:203306379-203306401 TAGAAGGAACAGGATGGGGTCGG - Intergenic
945879383 2:215310938-215310960 ATTAAAAAGGAGGATGGGGCCGG + Intergenic
945914268 2:215686265-215686287 TTGAAGAAGCACAAAGGGGTGGG - Intergenic
946110127 2:217407800-217407822 AGGTAGCAGCAGGGTGGGGTAGG - Intronic
946974960 2:225138541-225138563 AAGAGGAAGCAGAATTGGGTAGG + Intergenic
947229709 2:227872561-227872583 AGGAAGCAGCAGGATTGGGATGG - Intronic
947594082 2:231399932-231399954 CTGGAGAAGCAGGGTGCGGTGGG - Exonic
947671645 2:231940755-231940777 ATGCAGGACCAGGATGGGGTTGG - Intergenic
947981991 2:234418525-234418547 AGAAAGAAGCAGGCAGGGGTGGG - Intergenic
948001652 2:234572692-234572714 ATAAAGAATCTGGATGGGTTAGG + Intergenic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
949005301 2:241643171-241643193 ATGAAGAAGTAGGTTGGGTGTGG - Intronic
1168958336 20:1850077-1850099 GTGGGGAAGGAGGATGGGGTTGG + Intergenic
1169014406 20:2279984-2280006 AAGAAGAAGGAGGTTGGGTTTGG - Intergenic
1169291870 20:4359623-4359645 GGGAAGAAGGAGGATGGGTTTGG - Intergenic
1169535410 20:6533717-6533739 AAAAAGAAGCAGGCAGGGGTGGG - Intergenic
1170434840 20:16315666-16315688 AGCAGGAAGCAGGATGGGGCTGG + Intronic
1171138460 20:22719555-22719577 AGGGAAAAGCAGGGTGGGGTGGG + Intergenic
1171157992 20:22894163-22894185 TTCAAGAAGAAGGATGGTGTGGG - Intergenic
1171168549 20:22994746-22994768 TGGGAGAGGCAGGATGGGGTGGG - Intergenic
1173186207 20:40842524-40842546 ATGAAACAGCAGGAAGGGGTGGG - Intergenic
1173333778 20:42097057-42097079 ATGAAGCAGTAGGCAGGGGTTGG - Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173816344 20:45991446-45991468 ATCAAGAAGTAGGATGGGCCAGG + Intergenic
1173927853 20:46794018-46794040 ATGAAGAAGCAAAGTAGGGTGGG - Intergenic
1174360486 20:50026144-50026166 AGGACGGAGCAGGAGGGGGTGGG - Intergenic
1174387385 20:50195154-50195176 ATCCAGAAACAGGAGGGGGTGGG + Intergenic
1174436434 20:50510383-50510405 ATGAAGAAGCAGCAGCGGCTAGG + Exonic
1174449887 20:50613155-50613177 ATAAAGAAACAGGATGGGTGTGG + Intronic
1175091780 20:56510839-56510861 ATGAGGTAGGAGGATGAGGTGGG + Intronic
1175458926 20:59136236-59136258 ATGAAGCAGCAGCAGAGGGTAGG - Intergenic
1175679631 20:60976599-60976621 ACCAAGAAGTAGGATGGGTTGGG + Intergenic
1175935599 20:62512549-62512571 ATTAAGGAGCAGCAGGGGGTGGG - Intergenic
1178343517 21:31805863-31805885 ATGCAGAGGCAGGCTGGGGGTGG + Intergenic
1178598313 21:33974654-33974676 AGGAAGAAGGGGGATGGGGTGGG - Intergenic
1179195862 21:39161736-39161758 ATGAAGATGCAGGAAGGAGAGGG + Intergenic
1180048056 21:45318743-45318765 AGGAAGGGGCAGGATGGGGGTGG - Intergenic
1180204676 21:46251308-46251330 GTAAAGAAGCAGGCTGGGCTTGG + Intronic
1180211092 21:46295833-46295855 ATGAAGAAGTGGGGAGGGGTGGG - Intronic
1181137695 22:20780470-20780492 ATGAAGTAAAAGGATGGGCTGGG + Intronic
1181737271 22:24891974-24891996 ATGAAGGAGTAGGATGGTGGAGG + Intronic
1182102967 22:27670686-27670708 AGAAAGAAGCAGGCTGGGGAAGG - Intergenic
1182148247 22:28010737-28010759 ATGAAGCAGAAGGAAGGGGCTGG - Intronic
1182771366 22:32798979-32799001 ATGAAGATGCAGGCTGGGTGCGG - Intronic
1183029404 22:35092187-35092209 AGGAAGAAGCAGGTTTGGGGAGG - Intergenic
1183632048 22:39039558-39039580 ATTTAGAAGCAGGAGGGGTTGGG - Intergenic
1183637929 22:39076386-39076408 ATTTAGAAGCAGGAGGGGTTGGG - Intronic
1183650650 22:39151760-39151782 TTGAAGAAGGCAGATGGGGTAGG + Intronic
1183902522 22:41017269-41017291 ATGCAGAAGCAGGCTGGGCACGG - Intergenic
1184159969 22:42692285-42692307 GAGAGGAAGAAGGATGGGGTGGG + Exonic
1184328843 22:43812664-43812686 ACGAAGGCGCAGGATGCGGTAGG - Intergenic
1184928400 22:47660741-47660763 ATGAAGAAGGAGGAAGAGGAGGG - Intergenic
1185273319 22:49938439-49938461 ATGGAGAAGGCGGATGGGGCAGG + Intergenic
949999310 3:9644388-9644410 AAAAAGAAGCAAGATGGAGTTGG + Intergenic
950280440 3:11703179-11703201 ATGAGGAAACAGAATGGGCTTGG + Intronic
952957160 3:38564570-38564592 ATGAAGCATGCGGATGGGGTAGG + Intronic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
953768590 3:45762129-45762151 CTGATTCAGCAGGATGGGGTGGG + Intronic
953903861 3:46858496-46858518 GTGCAGAGGCATGATGGGGTGGG + Intronic
953996375 3:47523058-47523080 AGGCGGAAGCAGGATGGGGCAGG - Intergenic
954140987 3:48605345-48605367 ATGGAGAAGGATTATGGGGTGGG - Intronic
955691773 3:61598140-61598162 AAGAAGAATCAAGATGGTGTTGG - Intronic
956496341 3:69830595-69830617 ATGAAGCATCGGGATGGGGAGGG - Intronic
960202719 3:114857145-114857167 ATGAAAATGGAGGATGGGGTAGG - Intronic
960273978 3:115705989-115706011 ATAAGGAATCAGAATGGGGTAGG - Intronic
960715236 3:120568681-120568703 AGGAAGAAACAGGCTGGGGGAGG + Intergenic
960718369 3:120600584-120600606 AGGAAGATGAAGGAGGGGGTAGG - Intronic
960739282 3:120815109-120815131 TGGAAGAAGCAGGATTGGGCAGG - Intergenic
960854880 3:122092659-122092681 AAGGAGCAGCAGGAAGGGGTGGG - Intronic
961096980 3:124165900-124165922 GTGAACAAGCAGGAAGTGGTAGG - Intronic
961362477 3:126376643-126376665 GTGAAGAAGCCGGCTGGGGTTGG - Intergenic
961555923 3:127696708-127696730 ATGAAGAAGCATCATGGGGCCGG - Intronic
961719335 3:128882276-128882298 TGGAAGGAGCAGGATTGGGTGGG - Intronic
962207714 3:133448638-133448660 ATGAAGAGGTAGGAGGGGGCTGG + Exonic
963233851 3:142936389-142936411 ATGTTGAAGTAGGATTGGGTGGG - Intergenic
963308258 3:143678114-143678136 ATGAAGAGGCAGGCTGGGCGCGG - Intronic
963505002 3:146173336-146173358 CTGAAGAGGCAGGGTGGAGTTGG + Intergenic
963672796 3:148272713-148272735 AGGAAGGAGCTGGAAGGGGTTGG + Intergenic
963699483 3:148606853-148606875 AACAGGAAGCAGGATGGAGTTGG + Intergenic
964374432 3:156035591-156035613 AGGAGGAAGCAGGAGGGGGGAGG - Intergenic
964390070 3:156187479-156187501 TTCAAGAAGCAGGATGGAATGGG - Intronic
964672648 3:159244057-159244079 GTGAAGAAGGAGGCTTGGGTAGG + Intronic
965369912 3:167848710-167848732 ATGAAAAAACAGTATGGGCTGGG - Intergenic
966098451 3:176236298-176236320 ATGAAGAAGTAGAATGCAGTAGG + Intergenic
966248052 3:177830893-177830915 ATAAAGAAGCAGCATGGGAGTGG + Intergenic
966277869 3:178197502-178197524 TTGAAGAAGCGGGAATGGGTTGG + Intergenic
966495574 3:180576592-180576614 AGGAAGAAGTTGGATGGGGGAGG - Intergenic
966554230 3:181241106-181241128 ATAGAGAAGCTGGAAGGGGTGGG + Intergenic
966743034 3:183251591-183251613 ATGAAGAAGGAGGACCGTGTTGG - Intronic
966878086 3:184335045-184335067 CTGAAGAGGCAGGATGGCTTGGG + Exonic
966928375 3:184660050-184660072 ATGAAGGGGCAGGTTGGGTTTGG - Intronic
967512654 3:190329937-190329959 TTGAAAAAGTATGATGGGGTTGG + Intronic
968762310 4:2449130-2449152 ATGAAGGAGCAGGAGGGGGCCGG - Intronic
968914216 4:3490146-3490168 ATGAATGAGCAGGGTGGGGAAGG - Intronic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969104442 4:4794622-4794644 CAGAAGAAGCAGGATGGAGAGGG - Intergenic
969276441 4:6138982-6139004 ATGAACAGACAGGGTGGGGTGGG - Intronic
969625538 4:8303282-8303304 CCGAGGAGGCAGGATGGGGTGGG - Intronic
970347005 4:15162134-15162156 AAGAATAAGCAGGAGGAGGTGGG - Intergenic
971370830 4:26017457-26017479 ATGGAGAAGTTGGTTGGGGTTGG - Intergenic
971896796 4:32606485-32606507 CTGGAGCAGGAGGATGGGGTGGG + Intergenic
972171480 4:36350789-36350811 AAGAATAAGCAGGGTGGAGTGGG + Intergenic
972604822 4:40604327-40604349 ATGAAAAAGCATGATGGGCTGGG + Intronic
974692248 4:65311620-65311642 ATGATGAATCTGGATGGAGTTGG - Intergenic
974764292 4:66322194-66322216 ATGAAGAAGCTGGTTTGGTTTGG + Intergenic
975834204 4:78404553-78404575 ATACAGAAGGAGGAGGGGGTTGG - Intronic
975983946 4:80186182-80186204 GAGAAGAGGAAGGATGGGGTAGG + Intronic
976336634 4:83895454-83895476 ATGAAAAAGAAAGATGGGGGAGG - Intergenic
976502336 4:85806049-85806071 ATGAAGCAGCTGAATGGGGTAGG - Intronic
976598890 4:86919619-86919641 AAAAAGAAGCAGAATGGGGCCGG - Intronic
976967914 4:91067638-91067660 TTAAAGAAGAAGGATGGGGTGGG - Intronic
978257268 4:106707908-106707930 ATGATGAGGAAGGATGTGGTGGG + Intergenic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
979544283 4:121921812-121921834 AGGAAGCAGCAGGAGTGGGTGGG + Intronic
980453297 4:133005558-133005580 ATAAGGAAGCAGGGAGGGGTGGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981308294 4:143269398-143269420 AAGAAGATTCAGGATGGGCTCGG - Intergenic
981912749 4:150000739-150000761 CTGGAAAAGCAGAATGGGGTAGG - Intergenic
982080334 4:151783485-151783507 ATGAAGAAGTAGGCAGAGGTGGG - Intergenic
982966136 4:161910731-161910753 ATGAAGAAGCAAGCTGGGAGAGG - Intronic
983266833 4:165516146-165516168 ATGAAGCAGCAGGACCAGGTGGG + Intergenic
983734851 4:171044075-171044097 ACGAATCAGCAGGATGGGGTGGG + Intergenic
984267178 4:177509030-177509052 ATGATGAACCAGGGTGGAGTTGG + Intergenic
984269542 4:177534208-177534230 CTGGAGAAGCAGGAGGGAGTAGG + Intergenic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984623719 4:181981618-181981640 AGGTAGAAGCTGGAAGGGGTTGG + Intergenic
985157813 4:187010502-187010524 ATGAAGAAGCAGCATGAACTGGG + Intergenic
985563441 5:603485-603507 ATGAAGGAGCGGGTTGGGATGGG - Intergenic
986989107 5:13531201-13531223 AAGAAGAAGTAGGAAGGGGAGGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987909479 5:24123055-24123077 ATGAAAAACCAGGCTGAGGTGGG - Intronic
989466790 5:41765861-41765883 ATGAAGATGAGGGATGGGGGTGG - Intronic
989626838 5:43437809-43437831 TTAAAGAAGCAGGATGGGTCTGG + Intergenic
989666684 5:43862596-43862618 GTGAGGTGGCAGGATGGGGTGGG + Intergenic
990415524 5:55582493-55582515 AGGAAGCAGCAGGAGTGGGTGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
991369941 5:65907897-65907919 ATGAGGAAGAAGTAAGGGGTGGG + Intergenic
991985264 5:72278559-72278581 ATGAAGAAGCAGGATGGGGTTGG - Intronic
992106638 5:73453465-73453487 CTGAAGAAGCAGGGTGGGGGAGG - Intergenic
992543305 5:77785401-77785423 GTCCAGAAGCAGGATGGCGTTGG - Intronic
992969951 5:82046169-82046191 TTGGAGAAGCAGGAAGAGGTAGG - Intronic
992971390 5:82062609-82062631 AAGAAGAAGCAGGATGTGAATGG + Intronic
993050259 5:82918394-82918416 ATCAAGAAGCGGGGTGGGGCAGG - Intergenic
993691577 5:91007430-91007452 AGGCAGTAGCAGGATGGAGTAGG - Intronic
994329183 5:98486346-98486368 ATAAGAAAGGAGGATGGGGTGGG - Intergenic
994385950 5:99132009-99132031 ATGAAGAAACATGATGATGTAGG - Intergenic
995271089 5:110220312-110220334 ATGAAGAAGCTGCATGGTGCAGG + Intergenic
995616394 5:113969063-113969085 ATGAAGGAGAAGGATGGGAGAGG + Intergenic
995907438 5:117142498-117142520 AGGAAGAAGAAGGAGGGGGAGGG - Intergenic
997245456 5:132344729-132344751 ATGAAGCAGCATGAAGGGCTAGG + Intergenic
997751656 5:136352199-136352221 AAGAGAAAGCAGTATGGGGTAGG - Intronic
997786819 5:136721150-136721172 ATGAGGAAAGAGGATGTGGTAGG + Intergenic
998293530 5:140941608-140941630 ATTAAGAAGCAGGATGGGCTGGG - Intronic
999160733 5:149495499-149495521 TTAAAGAAGCAGGAGGGGCTGGG + Intronic
999659125 5:153840466-153840488 AGGAAGGAACTGGATGGGGTTGG - Intergenic
999749828 5:154619443-154619465 ATGAAGAAGGAGGGTCGGGGAGG + Intergenic
1000171326 5:158705731-158705753 AGGAAGGAGCAGGAAGTGGTTGG - Intronic
1001032060 5:168270242-168270264 TTGAAGTGGGAGGATGGGGTGGG - Intergenic
1001579935 5:172791576-172791598 ATGAAGAAGCTGGGTGTGGGTGG - Intergenic
1002021842 5:176368648-176368670 AGCTAGAAGCAGGGTGGGGTGGG + Intronic
1002092173 5:176812028-176812050 CTGAGGAGGCAGGATGGGGCGGG - Intronic
1002447037 5:179296105-179296127 GTGAAGCAGGAGGATGGGGGAGG + Intronic
1002617291 5:180463872-180463894 ATGCAGCAGCAGGATGGGCCTGG - Intergenic
1003822762 6:9918284-9918306 ATGGAGGAGCAGCATGTGGTGGG - Intronic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1005178610 6:23077279-23077301 ATGAAGATATGGGATGGGGTAGG - Intergenic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1007127021 6:39433866-39433888 CTGAACAAGCAGAATGGGGATGG - Intronic
1007227182 6:40323169-40323191 AGGAAGAAGCAGGATCAGGGTGG + Intergenic
1007665717 6:43511894-43511916 ATAAAGAGGAAGGAAGGGGTAGG + Exonic
1007754238 6:44088538-44088560 ATGAAGAAGGAGGCTGGGCACGG - Intergenic
1008403320 6:51090049-51090071 AGAATCAAGCAGGATGGGGTGGG - Intergenic
1009813923 6:68706285-68706307 ATGATGGAGCTGGCTGGGGTGGG + Intronic
1010585126 6:77650033-77650055 ATGAGGGAGCAGGATGGGAAAGG - Intergenic
1010982284 6:82381901-82381923 ATCCAGAAGGAGGATGGGGGTGG - Intergenic
1011128240 6:84029570-84029592 ATGAAGAGGCAGCATGGGGGTGG - Intergenic
1011490296 6:87884582-87884604 ATGAAGGCTCAGGATGGGGAAGG + Intergenic
1012271841 6:97222695-97222717 ATGAAAAAGGGGGATGGGGAGGG + Intronic
1012910464 6:105112120-105112142 CTGATGTAGCAGGCTGGGGTGGG - Intronic
1012988503 6:105900194-105900216 TTGAAAAAGCATGATGGGGGAGG + Intergenic
1013364843 6:109429265-109429287 GTGCAGAAGCAGGCTGGAGTAGG - Intronic
1013662242 6:112309427-112309449 ATGCAGAAGGAGGATTGGATGGG - Intergenic
1014571146 6:123009622-123009644 GGGAAGAGGCAGGATGGGGAGGG - Intronic
1016360299 6:143260348-143260370 CTGAAGAAGTTGGATGGGATAGG - Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1016805494 6:148208063-148208085 ATGAGGAAGCAGGAAGAGGTGGG - Intergenic
1017035368 6:150262422-150262444 ATGAAGAAGGAGGGTGGGGAAGG - Intergenic
1019101523 6:169634761-169634783 CTGAAGAAGGAGGACGGCGTGGG - Intronic
1019113803 6:169740465-169740487 GTAAAGAAGAAGGATGGGCTGGG - Intronic
1019522735 7:1468021-1468043 ATGGGGAAGGAGGATGGGGAGGG - Intergenic
1020660457 7:10974665-10974687 GTGCAGAAGCAGGGTGGGGAGGG - Intronic
1020795026 7:12668514-12668536 ATGTGGAAGCAAGGTGGGGTGGG + Intergenic
1020972414 7:14961772-14961794 AGAAAGAAGCAGGATTGTGTAGG - Intronic
1021061206 7:16115066-16115088 AGAATCAAGCAGGATGGGGTAGG + Intronic
1022466360 7:30655392-30655414 ATGAAGACCCAGGCTGGGATGGG + Intronic
1022593813 7:31692281-31692303 ATAAAGAAACAGGATTGGATTGG + Intronic
1023446035 7:40232572-40232594 ATTAAGAAGAAAAATGGGGTAGG + Intronic
1024112910 7:46164438-46164460 ATGAAGAAGCTGGAAGGAGCTGG - Intergenic
1024608867 7:51046046-51046068 GTGCAGAAGCAGGTGGGGGTGGG + Intronic
1024678573 7:51660344-51660366 AAGAAGGCGCAGGATGGGATAGG + Intergenic
1025039128 7:55624346-55624368 ATAAAGAAGCAAGATGTGGCTGG - Intergenic
1025778621 7:64579714-64579736 TTAAATAAGTAGGATGGGGTGGG + Intergenic
1025788759 7:64668075-64668097 TTAAATGAGCAGGATGGGGTAGG + Intronic
1025849314 7:65233035-65233057 CACAAGAAGCAGGGTGGGGTGGG - Intergenic
1026062932 7:67042544-67042566 ATAGAGAAGGAAGATGGGGTAGG + Intronic
1026474902 7:70726887-70726909 ATGAGGAAGGGGGATGGGATTGG - Intronic
1026715417 7:72784946-72784968 ATAGAGAAGGAAGATGGGGTAGG - Intronic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027648984 7:80841025-80841047 ATCAAGAAGCGGAATGGAGTGGG + Intronic
1028235388 7:88355002-88355024 CTGAATTAGCAGGATGGGATGGG + Intergenic
1028270657 7:88784687-88784709 AGGCAGAAGCAGGATTTGGTGGG - Intronic
1028537249 7:91903629-91903651 ATGAAGAACAAAGATGGAGTAGG - Intergenic
1028852409 7:95552218-95552240 ACCAATCAGCAGGATGGGGTGGG - Intergenic
1028947871 7:96601362-96601384 GTTTAGAAGGAGGATGGGGTGGG + Intronic
1029420616 7:100469942-100469964 CTGAGCGAGCAGGATGGGGTGGG + Intronic
1029859913 7:103559493-103559515 ATGAAGAAGATGCATGGGTTAGG - Intronic
1030879435 7:114858879-114858901 ATGAATAAGTAGGATGAGCTTGG + Intergenic
1031057588 7:117010489-117010511 ATGCAGATGCAGGCTGGAGTGGG + Intronic
1031366924 7:120912715-120912737 ATAAAGAAGCATTATGGGCTGGG + Intergenic
1031832135 7:126640744-126640766 AGGAAGAAGGAAGATTGGGTAGG - Intronic
1032193007 7:129775133-129775155 GTGAAGAGGTGGGATGGGGTGGG - Intergenic
1032709721 7:134451203-134451225 ATGAGGCAGGAGGATGGGGCTGG - Intronic
1033658869 7:143390494-143390516 AAGATGGAGCTGGATGGGGTGGG + Intronic
1033807872 7:144975313-144975335 CATGAGAAGCAGGATGGGGTGGG + Intergenic
1034359146 7:150478714-150478736 AGGAATAAGCAGGCTGGGGCTGG + Exonic
1036734913 8:11304402-11304424 AGGAAGAAGTAGGATGATGTTGG + Intronic
1037152354 8:15653169-15653191 TTGAGGAAGCAGTATGGTGTGGG + Intronic
1037510799 8:19579906-19579928 ATGAAGAAGAAGGAAGGGAAAGG + Intronic
1037934762 8:22908106-22908128 AAGATGGAGCAGGCTGGGGTTGG + Intronic
1038150939 8:24942088-24942110 AGGAGGAAGAAGGAGGGGGTAGG - Intergenic
1038487955 8:27949957-27949979 ATGAACAAGCAGGCTGGCCTTGG + Intronic
1038677910 8:29640211-29640233 CTGAAGAAGGAGGATAGGGAAGG + Intergenic
1038807561 8:30809367-30809389 ATCAACAAGGAGGATGGGGTAGG + Intronic
1039252219 8:35679294-35679316 AAGAAAAAGCAGGAAGGGGTGGG + Intronic
1039988378 8:42467113-42467135 ATCAACAAGCAGTATGGGCTGGG - Intronic
1040307843 8:46221444-46221466 ATGGAAAAGCAGGGTGGCGTAGG + Intergenic
1040533369 8:48283722-48283744 AAGAAGAAGCAGGAGGGAATGGG + Intergenic
1040643397 8:49368386-49368408 ATGAAGAGGCAGGTTTGGGGTGG - Intergenic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1042100568 8:65271516-65271538 ATGAAAAAGGAGGACGGGGGAGG + Intergenic
1042159219 8:65875112-65875134 ATCCAGAAGCAGGATGGAGTGGG + Intergenic
1042404643 8:68390147-68390169 AGAAAGAAGCAGGATGCAGTGGG + Intronic
1042695874 8:71554886-71554908 ATGTACAAGCAGTATGTGGTGGG + Intronic
1043166761 8:76912031-76912053 AAGAAGAAGAAAGATGGCGTGGG - Intergenic
1043377505 8:79667189-79667211 ATGAAGAAGCAGGCCGGGCACGG + Intergenic
1044460987 8:92443684-92443706 ATGAAGAAGGAGGAGCAGGTTGG + Intergenic
1044598579 8:93981534-93981556 AAGAAGAGGCTGGCTGGGGTGGG - Intergenic
1045322018 8:101089302-101089324 AGAAGGAAGGAGGATGGGGTAGG + Intergenic
1045648164 8:104319377-104319399 ATGAGGAAGGAGGAAGAGGTTGG + Intergenic
1045696113 8:104810547-104810569 TGGAAGAAGCAGGATAGGGTGGG + Intronic
1046215909 8:111146655-111146677 ATGAAGAAACACCATGGGGTGGG - Intergenic
1047276975 8:123413236-123413258 ATGAGGAAGCAGGGAGGAGTTGG - Intronic
1047324624 8:123824598-123824620 AGGAAGAGGCAGGATGGGGGTGG - Intergenic
1048215230 8:132487957-132487979 GTGAGGAAGCAGGATGAAGTCGG - Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049285279 8:141771539-141771561 ATCAAGAATCAGGATGGTGTTGG - Intergenic
1049755496 8:144309665-144309687 AGGAAGGGGCAGGCTGGGGTGGG - Intronic
1049986983 9:960831-960853 AAGATGAAGTAGGGTGGGGTGGG + Intronic
1050556089 9:6790744-6790766 ATTTAGAAGAAGGTTGGGGTGGG + Intronic
1050633462 9:7584587-7584609 ATGAGTAAGCATGGTGGGGTGGG + Intergenic
1050690400 9:8221172-8221194 AAGGAGAAGCAGGGTGGGGGAGG + Intergenic
1051017774 9:12501627-12501649 ATGAAGAAACAGTATGTGGTGGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1053008755 9:34621590-34621612 AAAAACAAGCAGGAGGGGGTAGG + Intronic
1053240673 9:36492325-36492347 ATGAAGAAAAAGGTAGGGGTGGG - Intergenic
1054706950 9:68472348-68472370 AAGAATAACCAGGAGGGGGTTGG - Intronic
1054942774 9:70761596-70761618 ATGAAGAAGAAGGAATTGGTAGG - Exonic
1055257399 9:74387574-74387596 ATCTAAAGGCAGGATGGGGTTGG - Intergenic
1055889974 9:81113561-81113583 ATGAAGAAGGAACAAGGGGTGGG + Intergenic
1056513353 9:87327100-87327122 AGGAAGAAGAAGGATGAGGAGGG + Intergenic
1056636912 9:88338787-88338809 ATGAAAAAGCAGCATGGGACTGG - Intergenic
1057050439 9:91919713-91919735 ATGAAGGAGCAGAGTGGGCTGGG - Intronic
1057097377 9:92324639-92324661 AGGAGGAAGAAGGCTGGGGTGGG - Intronic
1057337092 9:94164813-94164835 ATGATGAAGTAGGCTGAGGTGGG - Intergenic
1058443165 9:105029274-105029296 ATAAAGAATCAGGATGGGCTGGG - Intergenic
1059057962 9:111004391-111004413 TTGAAAAGGGAGGATGGGGTAGG - Intronic
1059349936 9:113657189-113657211 ATCAAGCAGCAGCAAGGGGTGGG - Intergenic
1060577998 9:124715750-124715772 TTGAAAAAGAAGGATGGAGTTGG + Intronic
1060666013 9:125432693-125432715 ATGTGGAGGCAGGAAGGGGTAGG + Intergenic
1061473708 9:130848169-130848191 ATGAAAAAGCATGCTGGGGAGGG - Intronic
1061755596 9:132809869-132809891 ATAAATAAGCAGGCTGTGGTCGG + Intronic
1061772029 9:132932657-132932679 ATGAAGAGGCAGAGGGGGGTTGG - Intronic
1185814493 X:3142397-3142419 AAGAAGAAGGAGGAGGAGGTGGG + Intergenic
1186026709 X:5321218-5321240 AACAAGATGTAGGATGGGGTGGG - Intergenic
1186550981 X:10505379-10505401 ATGAAGAAGCAGAATGGAAGGGG + Intronic
1188286354 X:28329377-28329399 AGTTAGAAGCAAGATGGGGTCGG + Intergenic
1188522488 X:31054278-31054300 CAGAAGAAACAGGATGGGGTAGG + Intergenic
1188947538 X:36325597-36325619 AGGATGAAGCAGGATTGAGTAGG + Intronic
1190087687 X:47409937-47409959 ATGAAGAAGGAGGCTGGGCGCGG - Intronic
1190236075 X:48616768-48616790 AGGAGGAAGCAGGATCGGGCAGG + Intergenic
1192433369 X:71127309-71127331 ATGAAGAAGCAAGGTTGGGAGGG - Intronic
1192496493 X:71619787-71619809 GGCAAGAAGGAGGATGGGGTTGG + Intergenic
1193806195 X:85997657-85997679 GTGAAGAAGCTGGCTGGGGGCGG + Intronic
1194668167 X:96698367-96698389 AGGAAGCAGCAGGAGAGGGTAGG - Intronic
1195659333 X:107362656-107362678 TTGAAGAAAAAGGTTGGGGTGGG + Intergenic
1197528766 X:127596178-127596200 ATGATGAAACAGTATCGGGTAGG - Intergenic
1197647975 X:129037985-129038007 ATGAAGATGCTGGGTGGGGGTGG + Intergenic
1198662398 X:138984110-138984132 AAGAAGAAGCAAGGTAGGGTGGG + Intronic
1198700393 X:139391358-139391380 ATGAAGTAGCAGGAGGAGTTTGG - Intergenic
1199440851 X:147866439-147866461 CTGCAGCAGCAGCATGGGGTGGG + Intergenic
1199851135 X:151725537-151725559 ATGGTGAAGCAGGATGCTGTGGG + Intergenic
1201267166 Y:12218530-12218552 ATCAATAAGAAGGATGGGTTAGG - Intergenic
1202384367 Y:24310648-24310670 ATCAAGAAGCTGGAAGGGCTAGG + Intergenic
1202486416 Y:25359474-25359496 ATCAAGAAGCTGGAAGGGCTAGG - Intergenic