ID: 991991479

View in Genome Browser
Species Human (GRCh38)
Location 5:72344144-72344166
Sequence CTGTGGGGTTGGAGGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991991467_991991479 24 Left 991991467 5:72344097-72344119 CCCTTAGGGCGGGAACCTACTGA 0: 1
1: 0
2: 0
3: 1
4: 44
Right 991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG No data
991991469_991991479 9 Left 991991469 5:72344112-72344134 CCTACTGAGCAGTGCTCTAGAGG 0: 1
1: 0
2: 1
3: 8
4: 99
Right 991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG No data
991991468_991991479 23 Left 991991468 5:72344098-72344120 CCTTAGGGCGGGAACCTACTGAG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 991991479 5:72344144-72344166 CTGTGGGGTTGGAGGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991991479 Original CRISPR CTGTGGGGTTGGAGGGAATG AGG Intronic
No off target data available for this crispr