ID: 991994780

View in Genome Browser
Species Human (GRCh38)
Location 5:72376278-72376300
Sequence ACTAGAGTTGTAGGTAGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994780_991994789 11 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994789 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
991994780_991994796 28 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994780_991994787 10 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994787 5:72376311-72376333 TCCGCCCAATCCAGCTGTGATGG No data
991994780_991994793 20 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994793 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG No data
991994780_991994794 21 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994794 5:72376322-72376344 CAGCTGTGATGGGACCATGAGGG No data
991994780_991994795 22 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994795 5:72376323-72376345 AGCTGTGATGGGACCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994780 Original CRISPR ACTAGAGTTGTAGGTAGGAA TGG (reversed) Intergenic