ID: 991994781

View in Genome Browser
Species Human (GRCh38)
Location 5:72376283-72376305
Sequence GGGGTACTAGAGTTGTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994781_991994794 16 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994794 5:72376322-72376344 CAGCTGTGATGGGACCATGAGGG No data
991994781_991994795 17 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994795 5:72376323-72376345 AGCTGTGATGGGACCATGAGGGG No data
991994781_991994796 23 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994781_991994789 6 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994789 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
991994781_991994793 15 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994793 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG No data
991994781_991994787 5 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994787 5:72376311-72376333 TCCGCCCAATCCAGCTGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994781 Original CRISPR GGGGTACTAGAGTTGTAGGT AGG (reversed) Intergenic