ID: 991994784

View in Genome Browser
Species Human (GRCh38)
Location 5:72376302-72376324
Sequence CTGGATTGGGCGGACCTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994784_991994793 -4 Left 991994784 5:72376302-72376324 CCCCATAGGTCCGCCCAATCCAG No data
Right 991994793 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG No data
991994784_991994796 4 Left 991994784 5:72376302-72376324 CCCCATAGGTCCGCCCAATCCAG No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994784_991994794 -3 Left 991994784 5:72376302-72376324 CCCCATAGGTCCGCCCAATCCAG No data
Right 991994794 5:72376322-72376344 CAGCTGTGATGGGACCATGAGGG No data
991994784_991994795 -2 Left 991994784 5:72376302-72376324 CCCCATAGGTCCGCCCAATCCAG No data
Right 991994795 5:72376323-72376345 AGCTGTGATGGGACCATGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994784 Original CRISPR CTGGATTGGGCGGACCTATG GGG (reversed) Intergenic