ID: 991994788

View in Genome Browser
Species Human (GRCh38)
Location 5:72376312-72376334
Sequence CCCATCACAGCTGGATTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994788_991994799 22 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994788_991994796 -6 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994788_991994801 28 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994788 Original CRISPR CCCATCACAGCTGGATTGGG CGG (reversed) Intergenic