ID: 991994790

View in Genome Browser
Species Human (GRCh38)
Location 5:72376315-72376337
Sequence GGTCCCATCACAGCTGGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994790_991994799 19 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994790_991994801 25 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data
991994790_991994796 -9 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994790 Original CRISPR GGTCCCATCACAGCTGGATT GGG (reversed) Intergenic