ID: 991994791 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:72376316-72376338 |
| Sequence | TGGTCCCATCACAGCTGGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 991994791_991994796 | -10 | Left | 991994791 | 5:72376316-72376338 | CCAATCCAGCTGTGATGGGACCA | No data | ||
| Right | 991994796 | 5:72376329-72376351 | GATGGGACCATGAGGGGACATGG | No data | ||||
| 991994791_991994799 | 18 | Left | 991994791 | 5:72376316-72376338 | CCAATCCAGCTGTGATGGGACCA | No data | ||
| Right | 991994799 | 5:72376357-72376379 | CTAACCAGTAGACCATTCGAAGG | No data | ||||
| 991994791_991994801 | 24 | Left | 991994791 | 5:72376316-72376338 | CCAATCCAGCTGTGATGGGACCA | No data | ||
| Right | 991994801 | 5:72376363-72376385 | AGTAGACCATTCGAAGGTGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 991994791 | Original CRISPR | TGGTCCCATCACAGCTGGAT TGG (reversed) | Intergenic | ||