ID: 991994796

View in Genome Browser
Species Human (GRCh38)
Location 5:72376329-72376351
Sequence GATGGGACCATGAGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994785_991994796 3 Left 991994785 5:72376303-72376325 CCCATAGGTCCGCCCAATCCAGC No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994790_991994796 -9 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994791_991994796 -10 Left 991994791 5:72376316-72376338 CCAATCCAGCTGTGATGGGACCA No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994784_991994796 4 Left 991994784 5:72376302-72376324 CCCCATAGGTCCGCCCAATCCAG No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994780_991994796 28 Left 991994780 5:72376278-72376300 CCATTCCTACCTACAACTCTAGT No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994782_991994796 19 Left 991994782 5:72376287-72376309 CCTACAACTCTAGTACCCCATAG No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994788_991994796 -6 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994786_991994796 2 Left 991994786 5:72376304-72376326 CCATAGGTCCGCCCAATCCAGCT No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data
991994781_991994796 23 Left 991994781 5:72376283-72376305 CCTACCTACAACTCTAGTACCCC No data
Right 991994796 5:72376329-72376351 GATGGGACCATGAGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991994796 Original CRISPR GATGGGACCATGAGGGGACA TGG Intergenic