ID: 991994799

View in Genome Browser
Species Human (GRCh38)
Location 5:72376357-72376379
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994788_991994799 22 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994791_991994799 18 Left 991994791 5:72376316-72376338 CCAATCCAGCTGTGATGGGACCA No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994790_991994799 19 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994792_991994799 13 Left 991994792 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994797_991994799 -2 Left 991994797 5:72376336-72376358 CCATGAGGGGACATGGTGATCCT No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data
991994786_991994799 30 Left 991994786 5:72376304-72376326 CCATAGGTCCGCCCAATCCAGCT No data
Right 991994799 5:72376357-72376379 CTAACCAGTAGACCATTCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type