ID: 991994801

View in Genome Browser
Species Human (GRCh38)
Location 5:72376363-72376385
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991994788_991994801 28 Left 991994788 5:72376312-72376334 CCGCCCAATCCAGCTGTGATGGG No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data
991994797_991994801 4 Left 991994797 5:72376336-72376358 CCATGAGGGGACATGGTGATCCT No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data
991994790_991994801 25 Left 991994790 5:72376315-72376337 CCCAATCCAGCTGTGATGGGACC No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data
991994792_991994801 19 Left 991994792 5:72376321-72376343 CCAGCTGTGATGGGACCATGAGG No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data
991994791_991994801 24 Left 991994791 5:72376316-72376338 CCAATCCAGCTGTGATGGGACCA No data
Right 991994801 5:72376363-72376385 AGTAGACCATTCGAAGGTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type