ID: 991996912

View in Genome Browser
Species Human (GRCh38)
Location 5:72396998-72397020
Sequence CATGCTTTGAAGGCTGAGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991996912_991996915 26 Left 991996912 5:72396998-72397020 CCATACTCAGCCTTCAAAGCATG No data
Right 991996915 5:72397047-72397069 CACAGCTTGAAAACAAGTCAAGG No data
991996912_991996916 27 Left 991996912 5:72396998-72397020 CCATACTCAGCCTTCAAAGCATG No data
Right 991996916 5:72397048-72397070 ACAGCTTGAAAACAAGTCAAGGG No data
991996912_991996914 -6 Left 991996912 5:72396998-72397020 CCATACTCAGCCTTCAAAGCATG No data
Right 991996914 5:72397015-72397037 AGCATGATGCTCACAGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991996912 Original CRISPR CATGCTTTGAAGGCTGAGTA TGG (reversed) Intergenic
No off target data available for this crispr