ID: 991998061

View in Genome Browser
Species Human (GRCh38)
Location 5:72407948-72407970
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991998055_991998061 18 Left 991998055 5:72407907-72407929 CCAAAGTGCATAAATAAGCAAGA No data
Right 991998061 5:72407948-72407970 CCACATGGATGGGACCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr