ID: 991998117

View in Genome Browser
Species Human (GRCh38)
Location 5:72408320-72408342
Sequence GATTTGCACTGAGTGGTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
991998109_991998117 24 Left 991998109 5:72408273-72408295 CCCCTGACCTAAGTGGAACCAAT No data
Right 991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG No data
991998114_991998117 6 Left 991998114 5:72408291-72408313 CCAATTAGATTGTCTCTGAGGAA No data
Right 991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG No data
991998111_991998117 22 Left 991998111 5:72408275-72408297 CCTGACCTAAGTGGAACCAATTA No data
Right 991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG No data
991998110_991998117 23 Left 991998110 5:72408274-72408296 CCCTGACCTAAGTGGAACCAATT No data
Right 991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG No data
991998112_991998117 17 Left 991998112 5:72408280-72408302 CCTAAGTGGAACCAATTAGATTG No data
Right 991998117 5:72408320-72408342 GATTTGCACTGAGTGGTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
991998117 Original CRISPR GATTTGCACTGAGTGGTTTC AGG Intergenic
No off target data available for this crispr