ID: 992003127

View in Genome Browser
Species Human (GRCh38)
Location 5:72454310-72454332
Sequence CTGCAAGGTGCTATGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992003127 Original CRISPR CTGCAAGGTGCTATGGAACC TGG (reversed) Intronic
902282680 1:15385918-15385940 CTGCAGGGAGCTGTGGACCCAGG - Intronic
903190550 1:21653404-21653426 TTGCAAGGTGCTCTGGAGCCTGG + Intronic
903827337 1:26155737-26155759 CCGCAAGGTGCTCTGGAATGTGG - Intergenic
904588051 1:31590953-31590975 CAGCAAGGGGCTGTGGGACCAGG - Intergenic
904916644 1:33975224-33975246 CTGCAAGGTGCAGTGGATCCAGG + Intronic
904965025 1:34365294-34365316 TTTCTAGGTGCTTTGGAACCAGG + Intergenic
907623855 1:56009935-56009957 CTGTGAGGTGCTGTGGAAGCGGG - Intergenic
908925222 1:69246296-69246318 CTGCAGGTTGCCATGGAAACAGG - Intergenic
909600518 1:77456700-77456722 CTGCATGGTTCTTTGGAACTAGG - Intronic
909735262 1:78951161-78951183 CTGTAAGCTGAGATGGAACCTGG - Intronic
910243709 1:85116064-85116086 CAGCAAGGTGAAATGGAGCCAGG - Intronic
912280247 1:108305125-108305147 CTGTGAGGTGCCATGGAAGCAGG + Intergenic
912287979 1:108389232-108389254 CTGTGAGGTGCCATGGAAGCAGG - Intronic
914941099 1:152023608-152023630 CTGCAAGGTCCTGGGGAACAAGG - Intergenic
915738651 1:158101231-158101253 GTGCAAGGTGCCATGGGGCCTGG + Intergenic
917586029 1:176426798-176426820 CTGTGAGGTGCTATGGAAGCAGG + Intergenic
918460387 1:184770665-184770687 CTCCAGGATGCTAGGGAACCTGG + Intergenic
922730016 1:227944931-227944953 CTGCAAGGTGCCAGGGAGCCAGG + Intronic
1065386146 10:25135099-25135121 CTGCCAGGGGCTATGGAAAGGGG - Intergenic
1074269998 10:111944625-111944647 CTGTGAGGTGCTGTGGAACTGGG - Intergenic
1078095479 11:8293814-8293836 CTGCAAGGCCCTGTGTAACCTGG + Intergenic
1078431502 11:11291994-11292016 CTGCAAGGAGCTTTGGAAGCTGG - Intronic
1078815949 11:14822818-14822840 CTGCAAGGTGCTGTGGACATGGG - Intronic
1081685641 11:45041273-45041295 CTGAAAGGTGAGGTGGAACCTGG + Intergenic
1086892198 11:92271155-92271177 CTGGAAGGTGTTATGGCACAAGG - Intergenic
1087085588 11:94215021-94215043 GTGCAAAGAGCTATGGAAACAGG - Intergenic
1092578979 12:9819313-9819335 CTGTGAGGTGCCATGGAAGCAGG - Intergenic
1095698383 12:45165583-45165605 CTGCAAGATGCCACGGAAGCAGG + Intergenic
1096938848 12:55318364-55318386 CTGACAGGTACTATGAAACCTGG + Intergenic
1099184537 12:79503392-79503414 CTGCAAAGTGCCGTGGAAGCGGG - Intergenic
1099253790 12:80290143-80290165 GTGCAAGGGGCCAGGGAACCAGG - Intronic
1099675376 12:85754779-85754801 CTGAAAGCTGCTTTGGAACTGGG + Intergenic
1100411449 12:94323124-94323146 CTGCAAGGTGCCATGGTAGTGGG + Intronic
1102855379 12:116288888-116288910 CTGTAGGGTCCTATGGAAACAGG + Intergenic
1104959410 12:132481088-132481110 CTGCACTTTGCTATGGAGCCTGG - Intergenic
1107727902 13:43318419-43318441 GTCCAAGGTGCTGTGGACCCAGG - Intronic
1108215521 13:48180193-48180215 TTGAAAGATGCTATGGAGCCTGG + Intergenic
1108470227 13:50759998-50760020 TAGCAATTTGCTATGGAACCAGG - Intronic
1113226765 13:108168253-108168275 CTGTGAGGTGCCATGGAAGCAGG - Intergenic
1114988566 14:28261410-28261432 CTGTGAGGTGCCATGGAAGCAGG - Intergenic
1116867456 14:50042388-50042410 CTGCATGGTCGTCTGGAACCAGG - Intergenic
1117026007 14:51620799-51620821 CTGCAAGCTGCTATGGGCCAAGG + Intronic
1120249835 14:82049902-82049924 CTGCAATGTGGTATGGAAGAAGG + Intergenic
1126734772 15:51719899-51719921 CTGCAAGGTGCTTTAGTACTTGG - Exonic
1129900220 15:79142059-79142081 CTGCAAGGTGGAGTGGAACCAGG + Intergenic
1132298157 15:100759450-100759472 CTGCAAGGAGCTCTGGAAAACGG + Intergenic
1133602189 16:7350423-7350445 CTACAAGGTGGAATGGGACCTGG - Intronic
1134211642 16:12282403-12282425 CTACAAGTTGCTTTGGAAGCAGG - Intronic
1135433605 16:22408839-22408861 CTGCAAGGCCCTATGCAATCTGG - Intronic
1137779159 16:51082697-51082719 CTGGAAGCTTCTATAGAACCAGG + Intergenic
1138127419 16:54450139-54450161 CTGAAAGGTGAGAAGGAACCAGG + Intergenic
1138997967 16:62476614-62476636 CTGCAAGGTACCATGGAAGCAGG + Intergenic
1140164436 16:72535001-72535023 CTGGAAGCTGCTATAGAACCAGG - Intergenic
1140247408 16:73263830-73263852 CTGGAAGGTGCTAAGCAACAGGG + Intergenic
1141544440 16:84755353-84755375 GTGCAAGGAGCTAGGGATCCAGG - Intronic
1142303836 16:89274694-89274716 CTGCAAGGTGCTGAGCACCCGGG + Intronic
1143415306 17:6743790-6743812 CTGCAAGGTGCCATGGAAGCAGG - Intergenic
1143474241 17:7193734-7193756 CTGCAAGGGGCTCTGAAACAGGG + Intronic
1145827468 17:27887862-27887884 CTGGAAGCTGCTGTAGAACCAGG + Intronic
1148767813 17:50049477-50049499 CTGCAAGGTGCTCTGTGGCCTGG + Intergenic
1149448526 17:56732341-56732363 CTCCAAGGTCCTATGGGACAGGG + Intergenic
1149448561 17:56732483-56732505 CTACAAGGTCCTATGGGACAGGG + Intergenic
1149448803 17:56733636-56733658 CTACAAGGTCCTATGGGACAGGG + Intergenic
1149448812 17:56733672-56733694 CTACAAGGTCCTATGGGACAGGG + Intergenic
1150789143 17:68186339-68186361 CTATAAGGTGATTTGGAACCAGG + Intergenic
1152423156 17:80204859-80204881 CAGCCAGGGGCTATGGAACTGGG + Intronic
1154102914 18:11492574-11492596 CTGCAAGGAGCTCTGGGACTAGG - Intergenic
1157993504 18:52526417-52526439 CTGCAAGGGGCTAGAAAACCTGG + Intronic
1163327862 19:16616832-16616854 CAGCAAGGGGCAAGGGAACCAGG + Intronic
1165181654 19:33976832-33976854 CTGCTAAGTGACATGGAACCAGG + Intergenic
1166645230 19:44526579-44526601 CTGCAAGAGACTATGGGACCTGG + Intronic
1166777605 19:45322507-45322529 CTGCAAGGGGCTGTTGAGCCAGG - Intronic
1168344854 19:55645184-55645206 CTGCAAAGTCCTGTGGTACCTGG - Exonic
925442344 2:3899438-3899460 TTGTGAGGTGCTATGGAAGCAGG + Intergenic
926216645 2:10909699-10909721 ATACAAGGTGCTGTGGAACCCGG - Intergenic
930939976 2:57000678-57000700 CTGCAAGGCACCATGGAAGCAGG + Intergenic
935948842 2:108311056-108311078 GTGGAAGTTGCTTTGGAACCTGG + Intergenic
937313112 2:120914381-120914403 CTGCAAGGTGCCAGGGTCCCTGG + Intronic
942311365 2:174660076-174660098 TGGCAAGGTGGTTTGGAACCAGG + Intronic
948482003 2:238256118-238256140 CAGCCAGGTGCTCAGGAACCTGG + Intronic
1169824307 20:9749858-9749880 CAGCAAGGAGATATGGAACTTGG - Intronic
1173599118 20:44280204-44280226 CTACACGGTGCCATGGAGCCGGG + Exonic
1174253014 20:49233512-49233534 CTGCAAGGTGGTAGGGAAGGAGG - Intronic
1175257204 20:57654710-57654732 CAGCAAAGTCCTATGGAACCAGG + Intronic
1179478949 21:41665824-41665846 CTGGAAGGGGCCATGCAACCTGG - Intergenic
1181402920 22:22662191-22662213 CTACAAGGAGCTATGGATCTTGG - Intergenic
1182085939 22:27561252-27561274 CTGCAAGGTCCCAGGTAACCAGG - Intergenic
1182582496 22:31323065-31323087 CTGCCAGGTGCTAAGCAGCCAGG + Intergenic
1183395670 22:37569412-37569434 CTGCAAGATGCTTGGGGACCTGG + Intergenic
949769439 3:7563381-7563403 CTGAAAAGTAATATGGAACCTGG - Intronic
955151416 3:56370901-56370923 CTGTAAGCTGCTTTAGAACCAGG - Intronic
961626365 3:128266591-128266613 ATCCAAGGAGCTCTGGAACCTGG - Intronic
961806464 3:129492743-129492765 CTGCAGTGTGCTAAGGAAGCTGG + Intronic
964845747 3:161042539-161042561 CTGCCAGGTGGCATGGAACTGGG - Intronic
966007269 3:175030889-175030911 CTGCAAAGTGCAATAAAACCAGG - Intronic
966151976 3:176875439-176875461 CTGCAAGATGCTGTGGAAGTGGG + Intergenic
967688821 3:192449457-192449479 CAGCAGGGTGCTGTGGAACCTGG - Intronic
969543028 4:7805724-7805746 CTGCACGGTGCTGTGGACACAGG + Intronic
969648091 4:8445394-8445416 CTGCAAGGCCCTATGTGACCTGG + Intronic
970555284 4:17225574-17225596 CTGCAAGGTGCGGTGGAAGCGGG + Intergenic
971003729 4:22351322-22351344 CTGTGAGGTGCCATGGAAGCAGG - Intronic
971100217 4:23458284-23458306 GTGCAAAGTGCTATTTAACCTGG - Intergenic
972305947 4:37830066-37830088 CTCCGAGCTGCTATGGGACCTGG + Exonic
977172161 4:93776554-93776576 CTGCATGTTGATATGGAGCCAGG - Intergenic
977587962 4:98795821-98795843 CTGTAAAGTGTTATGAAACCAGG - Intergenic
978042932 4:104092353-104092375 CTGCAAGGTGCCATGAAAGTAGG - Intergenic
978916582 4:114132550-114132572 CTGCAAGGTGCCATGAAAGCAGG + Intergenic
981801101 4:148657384-148657406 CTGCAGTGTGCTATGCAGCCTGG + Intergenic
982218098 4:153099775-153099797 CTGCAAGGTGCAATGGAAGAAGG - Intergenic
982817514 4:159905019-159905041 CTGCAGGGAGCTACGGATCCTGG - Intergenic
983831213 4:172330064-172330086 CTTCAAGGTGCAGTGGAAACAGG + Intronic
985845877 5:2346600-2346622 CTGCAAGGTGCCATGAAAGTGGG + Intergenic
987862508 5:23506317-23506339 CTGCAAGGAGATACGGAGCCTGG - Intergenic
991621763 5:68551948-68551970 CTCCAAGGTGCTATGGGGGCTGG + Intergenic
992003127 5:72454310-72454332 CTGCAAGGTGCTATGGAACCTGG - Intronic
998989928 5:147804379-147804401 CTGGAAGCTGCGATTGAACCTGG + Intergenic
1004185015 6:13414223-13414245 TTGCAAGATGCTAAGGAACAGGG - Intronic
1004561400 6:16755077-16755099 CTGCCAGGTGATATGTAAACAGG - Intronic
1006976508 6:38107378-38107400 CTGCAAGGTGCAGTAGAAACTGG + Intronic
1007191966 6:40027256-40027278 ATGCAAGGGTCTATGGAGCCAGG + Intergenic
1007381580 6:41493586-41493608 CTGAAAGATGCTTTGGAACAGGG + Intergenic
1015707533 6:136104288-136104310 ATGAAAGGTGCTGTGGAAGCTGG - Intronic
1021191678 7:17627635-17627657 CTCCTAGGTGTTATGGAAACAGG - Intergenic
1024165068 7:46722776-46722798 CTGCGAGGTGCCATGGAAGTGGG - Intronic
1026823819 7:73568587-73568609 CTGCAAGGTCCTGTGTAACCTGG - Intergenic
1035104709 7:156432548-156432570 CAGCAAGGTGCTACGGACCCCGG - Intergenic
1037797187 8:22005790-22005812 CTGCAAGGGGCTAGGGACCCAGG - Exonic
1040543141 8:48377164-48377186 CTGTAAGTTTCTAAGGAACCTGG + Intergenic
1041029400 8:53720475-53720497 CTGCTAGGAGCTAGGGCACCAGG + Intronic
1043735783 8:83741366-83741388 ATGTAAAGTGCTTTGGAACCGGG - Intergenic
1044115730 8:88330961-88330983 AAGCAAGATGCTATGGAACAGGG + Intergenic
1047954618 8:129964489-129964511 CTGCAAGGTGTTTTGGAAACGGG - Intronic
1048820743 8:138378411-138378433 CTGCAAGTTGCTTTGGAGTCTGG + Intronic
1050422188 9:5477547-5477569 CTGCAAGGTGGTAGGGAGGCTGG - Intergenic
1055798877 9:80009262-80009284 CTGGAAGCTGCTGTAGAACCAGG + Intergenic
1057792252 9:98132050-98132072 CTGCCAGGTGCTGGGGATCCGGG - Intronic
1060049756 9:120369831-120369853 CTGCTAGGAGCTATGCAACTTGG + Intergenic
1060141783 9:121216627-121216649 AAGCAAGGTACTACGGAACCTGG - Intronic
1061209164 9:129180972-129180994 CTGCCAAGTGCTGTGGGACCAGG + Intergenic
1062048215 9:134434103-134434125 CTCCAAGGGGCTCTCGAACCCGG + Exonic
1062524607 9:136973189-136973211 CTGCCAGGTGCTGTGGAGCTGGG - Intergenic
1188791406 X:34412152-34412174 CTGCAAGGTGCTGTGGAAGTGGG - Intergenic
1191877243 X:65809385-65809407 CTGCGAGGTGACATGGAAACAGG - Intergenic
1192095370 X:68205086-68205108 CTGAAAGGTGCTTTGGCAACTGG + Intronic
1192832803 X:74767886-74767908 CTGCAAGGTTCCATGGAAGTAGG + Intronic
1195969210 X:110455695-110455717 CTGCCAGGTGAAATAGAACCAGG - Exonic
1196060506 X:111403180-111403202 CTGCAAGGTGCCAGTGAATCTGG - Intronic
1197719061 X:129732486-129732508 CTGGAAGGGGCTTTGGAACTGGG + Intergenic
1198841979 X:140866663-140866685 CTGCAAGATGCTATGCAAGATGG + Intergenic
1200208050 X:154332217-154332239 CTGGAAGATGCCATGGACCCTGG + Intergenic
1201643122 Y:16199957-16199979 CTCCAAGGTGCTTTTGAGCCAGG + Intergenic
1201659693 Y:16385364-16385386 CTCCAAGGTGCTTTTGAGCCAGG - Intergenic
1202059152 Y:20867869-20867891 CTGCAAGGTGGTAGGGAGGCTGG - Intergenic