ID: 992005081

View in Genome Browser
Species Human (GRCh38)
Location 5:72469748-72469770
Sequence ATGCAAAATCATCTGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
992005077_992005081 -6 Left 992005077 5:72469731-72469753 CCCTAACATTCCTTGAAATGCAA 0: 1
1: 0
2: 0
3: 26
4: 272
Right 992005081 5:72469748-72469770 ATGCAAAATCATCTGGAGCCTGG No data
992005078_992005081 -7 Left 992005078 5:72469732-72469754 CCTAACATTCCTTGAAATGCAAA 0: 1
1: 0
2: 1
3: 24
4: 307
Right 992005081 5:72469748-72469770 ATGCAAAATCATCTGGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
992005081 Original CRISPR ATGCAAAATCATCTGGAGCC TGG Intronic
No off target data available for this crispr